Овернайт бкс: БКС Брокер — Доход по займам Овернайт

Содержание

Инвестиционная энциклопедия — инвестиционные статьи и финансовые материалы за 28 мая 2021 — Invest-Rating.ru

Здоровье
ИИИ: 8.9, Д/Р: 2/4
Форекс
ИИИ: 8.7, Д/Р: 9/9
Нефть, газ, сырье
ИИИ: 8.6, Д/Р: 6/4
Акции
ИИИ: 8.5, Д/Р: 7/5
Биткоин
ИИИ: 8.4, Д/Р: 8/6
Облигации
ИИИ: 8. 3,
Д/Р
: 5/4
Накопительные программы
ИИИ: 8.2, Д/Р: 3/2
ИИС
ИИИ: 8.1, Д/Р: 7/4
Недвижимость
ИИИ: 8, Д/Р: 5/5
Криптовалюты
ИИИ: 8, Д/Р: 9/10
Наличные деньги
ИИИ: 7.9, Д/Р: 0/1
Банковские депозиты
ИИИ: 7. 8, Д/Р: 4/2
ПИФы
ИИИ
: 7.8, Д/Р: 6/5
Структурные ноты
ИИИ: 7.7, Д/Р: 6/6
ПАММ счета
ИИИ: 7.7, Д/Р: 8/8

Ставка рефинансирования: ждать ли изменений?

Снижение ставки рефинансирования Банком России в ближайшее время вполне возможна, но это не окажет серьезного влияния на финансовые рынки, считают эксперты.

16 мая Центробанк понизил на 0,25% ставки по отдельным операциям. Правда, все они относятся к разряду второстепенных, основные ставки, например по кредитам «овернайт» или краткосрочным сделкам РЕПО, не говоря уже о ставке рефинансирования, решено было оставить без изменений. Тем не менее, с учетом того, что в апреле ЦБ уже понижал ряд второстепенных ставок, в финансовых кругах начали активно муссироваться слухи о том, что регулятор готовится к снижению ставки рефинансирования (которая, напомним, с сентября прошлого года держится на уровне 8,25%). Насколько это вероятно, и как отразится на рынках возможное понижение основной кредитной ставки, портал «БанкИнформСервис» спросил у экспертов.

«Снижение ставок по отдельным операциям увеличивает вероятность такого шага, как снижение ставки рефинансирования со стороны ЦБ РФ, но срок снижения ключевых ставок будет определяться темпами инфляции и роста экономики, привязки к конкретным датам в действиях ЦБ РФ делать не стоит, - предостерег от поспешных выводов управляющий филиалом «Уральский» Банка Интеза Алексей Серебряков. - Ожидание изменений в июне-июле связано, скорее, с тем, что 24 июня 2013 г. заканчивается срок полномочий нынешнего Председателя ЦБ РФ Сергея Игнатьева и приход Эльвиры Набиуллиной ассоциируется со сменой курса».

Но даже если регулятор и понизит ставку рефинансирования, это не особенно заметно скажется на деятельности финансовых рынков, в частности, кредитного и валютного.

«Эффект будет незначительным, поскольку уровень ставки рефинансирования не так чувствителен для рынка, как, например, уровень ставок по операциям РЕПО или депозитной ставки ЦБ РФ, - считает Алексей Серебряков. - Эффект от действий ЦБ РФ, как правило, проявляется с определенным лагом 3 - 6 месяцев. И, наконец, учитывая значительные ожидания по смягчению денежно-кредитной политики ЦБ РФ, ряд крупных банков уже начали постепенное снижение ставок по кредитным и депозитным продуктам».

«Глобальных изменений ждать не стоит, - соглашается директор Екатеринбургского филиала банка БКС Премьер Григорий Вахитов. - Воздействие ставки рефинансирования на кредитный рынок во многом ограничено объемами кредитования со стороны ЦБ и списком банков, которые эти кредиты получают. Поэтому ставка является скорее индикативной. А на кредитный рынок больше влияют решения крупных игроков. Валютный рынок также не почувствует сильных изменений».

«Снижение ставки рефинансирование напрямую не заставит банки снижать ставки по кредитам населению или бизнесу

, - рассуждает вице-президент Свердловского областного союза промышленников и предпринимателей Анатолий Сысоев. - Поскольку в России отсутствуют ограничения на взимаемую банками маржу по кредитам, ставка рефинансирования и ее изменения не могут быстро и непосредственно влиять на кредитный рынок и политику банков».

Не стоит, по мнению, экспертов, ждать от гипотетического снижения основной ставки и какого-либо влияния на инфляцию. «Инфляция не особо зависит от ставки рефинансирования, гораздо больше она зависит от цен и тарифов естественных монополий, а там ценообразование зачастую происходит нерыночным путем», - пояснил по этому поводу Григорий Вахитов.

Тинькофф Инвестиции Премиум: обзор и отзывы

В сегоднешнем обзоре подробнее рассмотрим Тинькофф Инвестиции Премиум, все плюсы и минусы данного тарифа. Еще весной 2018 года Тинькофф банк получил лицензию на брокерскую и депозитарную деятельность, и необходимость в посреднике "БКС Брокер" для обслуживания счетов в Тинькофф Инвестициях пропала. С мая 2018 года банк самостоятельно открывает брокерские счета для своей инвестиционной платформы. На апрель 2021 года, по данным Московской биржи, брокер находился на 1-й строчке по общему числу зарегистрированных клиентов, открыв более 5,18 млн счетов и опережая Сбербанк на более чем 500 тысяч клиентов.

Банк обещает, что в сервисе Тинькофф Инвестиции "все проще, чем кажется".

Открытие брокерского счета

Заявку на открытие брокерского счета можно оформить на сайте банка онлайн. Для этого необходимо иметь премиальную карту банка (например Tinkoff Black Metal). Если у вас ее нет, то вместе с документами на открытие брокерского счета вам привезут бесплатную карту Tinkoff Prime. Данный процесс занимает около 2-5 дней, но иногда случаются задержки. Действующим клиентам Тинькофф Банка для открытия брокерского счета встречаться с курьером не нужно, достаточно просто подтвердить заявку кодом из смс. После получения документов и карты (если есть необходимость) у вас появляется возможность покупать акции, облигации, валюту в Тинькофф Инвестициях.

Карта Tinkoff Prime для клиентов с тарифом Инвестиции Премиум будет бесплатной. При этом приятные бонусы примальной карты от банка вам будут доступны. А именно круглосуточный консьерж-сервис в приложении Prime, бесплатная страховка в путешествиях - для всей семьи, до 100 000 $, включая активный отдых и доступ в бизнес-залы Lounge Key для вас и ваших спутников (2 прохода в месяц). Если вы уже являетесь держателем премиально карты от Тинькофф банка, то вам Tinkoff Prime не понадобится.

Сколько стоит обслуживание

На тарифе Премиум плата за обслуживание списывается независимо от того, были у вас сделки в текущем расчетном периоде или нет.

Плата за обслуживание будет списываться авансом - в тот же день, когда вам подключили премиум-тариф.

0 руб/мес - если в прошлом расчетном периоде на вашем брокерском счете было больше 3 млн/руб - учитываются все активы в начале каждого дня.

990 руб/мес - если в прошлом расчетном периоде на вашем брокерском счете было от 1 до 3 млн/руб - учитываются все активы в начале каждого дня.

3 000 руб/мес - в остальных случаях.
Персональный менеджер

Тинькофф Инвестиции Премиум предоставляет персонального менеджера, который с вами с самого начала. Он поможет решить любой вопрос, связанный с инвестициями и доступен в любое время. Например, поможет составить диверсифицированный портфель с учетом индивидуальных пожеланий и предпочтений.

Простота покупки акций, облигаций и валюты и доступ к ценным бумагам мировых бирж

Для работы с Тинькофф Инвестициями не нужно устанавливать специальный терминал (например Quik), регистрировать ключи доступа нет необходимости. Все сделки совершаются с помощью личного кабинета или мобильного приложения "Тинькофф Инвестиции", которое банк предоставляет бесплатно. Само приложение или личный кабинет прост и интуитивно понятен. Процесс покупки достаточно прост, необходимо зайти в интересующий раздел (акции, облигации, валюта) и совершить выбор, указать нужное количество ценных бумаг или валюты и расплатиться с помощью карты Тинькофф. Можно заранее пополнить брокерский счёт с карты и оплатить бумаги с него.

Имеется возможность покупки иностранных акций с долларового или еврового счета Тинькофф. Если использовать рублевый счет, то будет конвертация в доллары или евро по курсу банка. Также предусмотрена возможность купить валюту для покупки иностранных акций на бирже.

В Тинькофф Инвестициях Премиум клиентам доступно более 10 000 ценных бумаг эмитентов из 30 стран. Сотни иностранных ETF, евробонды (включая высокодоходные развивающиеся рынки), акции и облигации зарубежных компаний. Но для покупки этих бумаг недостаточно подключить тариф Премиум. Расширенный список ценных бумаг доступен только квалифицированным инвесторам.

Получения статуса квалифицированного инвестора

Для получения статуса квалифицированного инвестора необходимо выполнить одно из условий.

  • иметь бумаги на 6 млн/руб,
  • держать эту же сумму на депозитных счетах,
  • пройти обучение и получить сертификат, либо иметь опыт работы в организации, которая совершала сделки с ценными бумагами или деривативами от 2 лет.

На наш взгляд самый простой способ получить статус квалифицированного инвестора - это предоставить документы о том, что на счетах у вас имеется 6 млн/руб. Необязательно все деньги должны быть в Тинькофф банке, можно также предоставить бумаги о наличие у вас денег из других банков. После получения этого статуса деньги снова можно вывести куда вам необходимо, держать их на счетах постоянно нет необходимости. Присваивание статуса квалифицированного инвестора происходит бесплатно.

Отсутствие скрытых комиссий и низкий процент за сделку

Ввод и вывод денежных средств с брокерского счета осуществляется без комиссии сразу же на карту Tinkoff Black Metal или просто Tinkoff Black. При выводе денег с брокерского счета Тинькофф самостоятельно удерживает налоги (за исключением части налога от иностранных дивидендов).

- Покупка или продажа акций, паев ПИФ, паев или акций ETF, депозитарных расписок из расширенного списка стоит 0,25%, из базового списка 0,025%.
- Покупка или продажа облигаций и еврооблигаций из расширенного списка - от 0,25% (при сумме сделки от 1.5 млн/руб или 25 000 долларов США или евро) до 1% (при сумме сделки до 1.5 млн/руб или 25 000 долларов США или евро).

- Покупка или продажа структурных нот из расширенного списка - от 1% до 4% (зависит от срока действия структурных нот).
- Покупка или продажа других финансовых инструментов - 2% от суммы сделки.

Кроме комиссии за сделку и плату за обслуживание Тинькофф никаких больше комиссий не берет.

Займы овернайт

Раньше Тинькофф брокер хранил свои деньги отдельно от средств клиента и в случае банкротства брокера, можно было вернуть средства. Сейчас Тинькофф подключил займы овернайт, но их можно отключить. Это можно сделать в мобильном приложение или в личном кабинете.

В Тинькофф Инвестициях для всех тарифных планов доступен торговый терминал и стакан котировок.

БКС: РОССИЙСКИЙ РЫНОК — ХОД ТОРГОВ (28 сентября 2007г.

)

В пятницу рынок стартовал с незначительного плюса, но ближе к середине торговой сессии появляется все больше пессимистичных оттенков торгов.
На утро погода была почти безоблачна за исключением неудовлетворительной внутренней ликвидности: Америка прибавила более половины процента, нефть выстрелила на 3%, Азия не давала сигналов. Но под конец квартала ситуация с ликвидностью — соответствующая. Ставки овернайт МБК держаться на уровнях 7,5%. В течение сессии так же вмешивается такой негативный фактор, как снижение фьючерсов на американские индексы.
На этом фоне к 12:50 мск. индекс РТС снижается на 0.05%, а индекс ММВБ теряет 0.17%.В пятницу рынок стартовал с незначительного плюса, но ближе к середине торговой сессии появляется все больше пессимистичных оттенков торгов.
На утро погода была почти безоблачна за исключением неудовлетворительной внутренней ликвидности: Америка прибавила более половины процента, нефть выстрелила на 3%, Азия не давала сигналов. Но под конец квартала ситуация с ликвидностью — соответствующая. Ставки овернайт МБК держаться на уровнях 7,5%. В течение сессии так же вмешивается такой негативный фактор, как снижение фьючерсов на американские индексы.
На этом фоне к 12:50 мск. индекс РТС снижается на 0.05%, а индекс ММВБ теряет 0.17%. Голубые фишки торгуются разнонаправлено. В лидерах снижения пока пребывает Норникель, теряя к 12:50 мск. 1.12%. В полупроцентном минусе торгуются РАО ЕЭС, Роснефть, Татнефть. На положительной территории находится Лукойл, прибавляющий 0.3% на ММВБ.
Продолжают сокрушать неоправданно большой дисконт к обыкновенным акциям привилегированные акции Сургутнефтегаза, прибавляющие более 4%.
Региональные телекомы сегодня взяли паузу после канунного спурта.
Продолжают снижение акции ВТБ, потерявшие на текущий момент на ММВБ 2.86%. Негатив в банковский сектор привносят торги в Европе, где финансовый сектор возобновил снижение на фоне падения акций Northern Rock. Пострадавший от кредитного кризиса британский банк потерял 4.65% после сообщений о его новом займе у Банка Англии в размере пяти миллиардов фунтов.
К слову в США сегодня будут опубликованы немаловажные данные по потребсектору и по PCE, что даст понимание относительно инфляционных процессов в августе и о потребительской силе. Что касается сегодняшнего закрытия российской сессии, то пока предсказать настроения на закрытии сложно.

Дмитрий Савченко,
аналитик ИК «Брокеркредитсервис»

Торговля на фондовом рынке США

Помимо разнообразия инструментов, присутствия компаний из всех секторов экономики и прочих фактических различий, которые отличают фондовый рынок США от других мировых финансовых рынков, необходимо отдельно коснуться таких важных вопросов, как расписание торгов на американском рынке, специфики выставления заявок и совершения сделок, комиссиях, подлежащих уплате и о том, в каких ситуациях какие виды заявок следует выставлять.

В целом американский фондовый рынок устроен аналогично другим зарубежным рынкам, и различия в специфике заявок довольно незначительны, но тем не менее их нужно понимать и принимать во внимание в случае, если вы собираетесь инвестировать в американские акции.

Торговая сессия на фондовом рынке США включает три основных блока:

  1. Pre-market — предторговая сессия, стартует в 4 утра по Нью-Йорку (далее везде время местное)
  2. Regular trading hours — основная сессия, длится с 9-30 до 16-00.
  3. After-hours — послеторговая сессия, длится с 16-00 до 20-00.

Биржевые торги проводятся ежедневно, кроме выходных (субботы и воскресения) и праздничных дней (в Америке 9 государственных праздников, во время которых торги не проводятся).

Ознакомиться с расписанием торгов и узнать, какие дни относятся к праздничным в текущем году, можно на сайте биржи по этой ссылке.

Итак, торговая сессия рынка США длится 16 часов — с 4-00 до 20-00, однако классические нормальные торги идут только в процессе основной сессии (6,5 часов), и есть некоторые особенности проведения премеркета и послеторговой сессии, которые необходимо учитывать.

Премаркет длится 5,5 часов. Ликвидность этой сессии крайне мала, так как большинство участников торгов в это время спит. Ликвидность присутствует только в самых крупных компаниях, либо в тех, по которым до открытия торгов произошло серьезное корпоративное событие (выход отчетности, публикация важной новости). Помимо возможности купли-продажи ценных бумаг, в ходе предторговой сессии так же можно заранее выставить заявки на основную сессию.

Основная сессия — это наиболее активное время торгов, большая часть оборотов приходится на первый час торгов и на период перед закрытием основной сессии. Как правило большинство тенденций дня определяется в первый час торгов, особенно если не выходит каких-либо важных неожиданных новостей. Как правило все важные новости (публикация статистики и отчетности компаний) приходится на период премаркета и первый час основной сессии, поэтому в первый час торгов чаще всего и определяется генеральная тенденция дня. В свою очередь перед закрытием становятся наиболее актуальными сделки среднесрочных инвесторов, которые в своих торговых решениях ориентируются на дневной график и совершают сделки по итогам формирования дневных свечей. К тому же еще одна порция важных новостей (например, итоги заседания ФРС, публикуемые как правило около 14-00 по местному времени) приходится именно на период завершения основной сессии или публикуются сразу после ее завершения.

Послеторговая сессия по основным признакам напоминает премаркет — низкая ликвидность (закрытие Американского рынка приходится на период информационного затишья в том числе на всех мировых рынках, так как Азиатская сессия открывается с некоторым перерывом). Ликвидность опять же формируется в тех бумагах, по которым произошли корпоративное событие (выход отчетности, важные новости), и инвесторы имеют возможность купить или продать ту или иную бумагу, не дожидаясь открытия основной сессии завтрашнего дня.

Итак, основные объемы традиционно сосредоточены в основной торговой сессии, а премеркет и послеторговая сессия используются только в критических ситуациях, когда необходимо оперативно принять решение о купле-продаже отдельной бумаги.

Так же существует определенная специфика в выставлении заявок в разные периоды торговой сессии на рынке США, но для этого нам необходимо разобраться с тем, какие виды заявок можно выставлять на американском рынке.

В принципе в биржевых заявках на фондовом рынке США достаточно мало специфики по сравнению с другими рынками.

По направлению операции различают заявки на покупку (buy) и продажу (sell). При этом специфичным для американского рынка (по сравнению с российским) является выставление разных типов заявку на покупку для открытия длинной и закрытия короткой позиции и продажу для открытия короткой и закрытия длинной позиции.

Чтобы открыть длинную позицию — выставляется заявка buy, а для закрытия короткой позиции — buy to cover. Аналогично для продажи имеющихся ценных бумаг (закрытия длинной позиции) используется заявка sell, а для открытия короткой позиции — sell short. Это правило действует не во всех американских торговых терминалах, но некоторые из них требуют соблюдения правил выставления заявок с учетом вашей текущей позиции.

Что касается типа ордеров, то здесь различают стандартные и специфические для американского рынка заявки.

К стандартным относятся:

  1. Рыночный ордер — покупка или продажа по текущей цене (лучшей цене спроса / предложения).
  2. Лимитный ордер — это заявка по определенной цене, не хуже заданного уровня.
  3. Стоп-лимитный ордер — условная заявка, активирующая рыночный или лимитный ордер при достижении определенного условия (прохождении ценой заданного уровня).

Помимо стандартных, на американском рынке существуют две специфические заявки:

  1. Заявка по открытию (Market At Open) — выставляется до открытия основной сессии и исполняется по цене открытия рынка.
  2. Заявка по закрытию (Market At Close) — выставляется в течение основной сессии и исполняется по цене закрытия рынка.

Прочие важные параметры при вводе заявки касаются срока их действия. Здесь различают три основных вида:

  1. Day — заявка исполняется в течение основной сессии текущего торгового дня.
  2. GTC — заявка активна до отмены или исполнения.
  3. GTN — заявка может быть исполнена в течение основной и послеторговой сессии.

Дополнительно вы можете определить параметр «видимое количество», выставив заявку типа «Айсберг», в которой общее количество лотов ордера будет скрыто из стакана, а отображаться будет то число лотов, которое вы указали в поле видимое количество. Эти заявки используются для того, чтобы скрыть реальный объем своих сделок от прочих участников торгов.

Так же в поле ввода заявки можно определить роутер — площадку для исполнения заявки (то есть выбрать тот ECN, на котором вы хотите свою заявку исполнить). По умолчанию выставляется маршрут smart — заявка отправляется брокером, который выбирает ECN по своему усмотрению исходя из наиболее выгодной цены исполнения.

Различные типы заявок имеют свои особенности исполнения.

Рыночный ордер исполняется по текущей рыночной цене (лучшей цене спроса или предложения на текущий момент), исполнение идет поступательно от лучшей цене к худшей до исполнения полного объема, указанного в заявке.

Рыночные заявки нельзя выставлять во время предторговой и послеторговой сессии, так как в связи с низкой ликвидностью выставления рыночных заявок может привести к тому, что ваша заявка будет исполнена по цене значительно хуже текущей.

Лимитный ордер активируется сразу после выставления и исполняется при достижении указанной в нем цены. Цена лимитного ордера для покупки должна быть ниже текущей рыночной цены, а для продажи — выше текущей рыночной цены. Лимитный ордер может быть исполнен в любой период основной сессии для ордера со сроком исполнения Day и в период основной и послеторговой сессии для ордера со сроком исполнения GTN.

Стоп-ордера так же выставляются и исполняются только в период основной сессии по той же причине (низкая ликвидность). Стоп заявка может быть как рыночной, так и лимитной, и активируется в случае, если цена поднимается выше указанного в ней уровня для покупки или опускается ниже указанного уровня для продажи.

Заявки Market At Close могут быть выставлены в любой период основной сессии, а исполняются по цене закрытия основной сессии, полностью или частично в зависимости от объемов, которые выставили контрагенты на встречную операцию. Исполнение этих заявок происходит в 16-00 по местному времени, при этом данную заявку невозможно снять за 15 минут до конца основной сессии.

Заявки Market At Open так же активируются сразу, а исполняются по тем же принципам в 9-30 утра, по цене открытия основной сессии.

Основные затраты инвестора при торговле на американском рынке можно разделить на три основные группы:

  • Комиссия за исполнение сделки
  • Комиссия за использование заемных средств
  • Комиссия за неторговые операции

Основная статья затрат — это комиссия брокера, которая может быть как в форме процента от объема сделки, так и фиксированной суммой (за каждую акцию или за каждую сделку). При этом при наличии фиксированной комиссии за сделку тарифом так же может быть предусмотрена дополнительная плата за объем (когда вы дополнительно платите процент от оборота при превышении установленного порога).

Помимо брокерской комиссии, так же существует комиссия биржи (поступает на счет биржи или ECN, на которой прошла сделка), клиринговая комиссия (поступает на счет DTC) и транзакционная комиссия — списывается только за продажу бумаг и составляет не более 0,002% от сделки. Часто тариф брокера включает в себя все прочие комиссии, поэтому вы платите только брокеру, а он уже рассчитывается со всеми прочими участниками самостоятельно.

Комиссия за использование заемных средств взимается в случае, если вы используете маржинальное кредитование, то есть заемные средства, которые предоставляет вам брокер на покупку и продажу ценных бумаг. Если вы используете заемные средства, за них вы платите брокеру предусмотренный вашим тарифом процент годовых — из расчета за каждый день пользования кредитом. Определенное удобство заключается в том, что на американском рынке расчеты по сделкам происходят в режиме Т+3 (по заключенным сегодня сделкам поставка и оплата происходят на третий рабочий день), а значит маржинальные позиции в течение 3 дней будут для вас бесплатными.

Комиссия за неторговые операции взимается при подаче заявок на вывод средств и на совершение действий, связанных с участием в корпоративных событиях.

Есть еще одна специфическая особенность биржевой комиссии в США: она взимается с трейдеров, удаляющих ликвидность (то есть совершающих рыночные сделки и забирающих объем из стакана) и начисляется трейдерам, добавляющим ликвидность (то есть выставляющим лимитные ордера в стакан). Это сделано для того, чтобы стимулировать трейдеров к созданию ликвидности на рынке.

2014 BCS National Championship Среднее значение 15,7 Рейтинг за ночь

Комбинированное среднее значение из пяти игр для боулов BCS увеличилось на 10% по сравнению с 2013 годом

Освещение

ESPN «BCS Megacast» национального чемпионата VIZIO BCS - № 1 штата Флорида над № 2 Оберн 34–31 в понедельник, 6 января - в среднем за ночь составила 15,7 балла по каналам ESPN, ESPN2 и ESPNEWS (дополнительные восемь продуктов варианты не получают ночевки). Телепередача только для ESPN за ночь получила в среднем 15,3 рейтинга.

Рейтинг рынка с измерением в 15,3 - самый высокий для всего кабельного телевидения с января 2013 года, когда проводился национальный чемпионат BCS по ESPN - помог довести средний показатель BCS для пяти игр до рыночного рейтинга 9,9, что на 10% больше по сравнению с рейтингом 9,0. за пять прошлогодних игр. Игра также была самой популярной программой в понедельник, помогая ESPN выиграть ночь среди всех сетей.

Бирмингем лидирует на всех рынках по телетрансляции с рейтингом 55,8, став третьей по рейтингу игрой в боулинг на ESPN на рынке после чемпионатов BCS 2011 и 2012 годов.Джексонвилл был вторым по рейтингу рынком с рейтингом 31,1, за ним следуют Ноксвилл (26,6), Атланта (25,8), Орландо (24,9), Тампа-Сент. -Петербург (24,2), Мемфис (24,1), Гринвилл (24,0), Нэшвилл (23,5) и Шарлотта (22,2). Помимо того, что он попал в десятку лучших рынков, матч за титул также был самым рейтинговым игроком на ESPN в Джексонвилле, Орландо и Тампа-Стрит. Петербург. Все рыночные данные датированы 2000 годом.

Телепередача ESPN о национальном чемпионате VIZIO BCS 2014 года стала крупнейшей на сегодняшний день трансляцией студенческого футбольного матча с различными вариантами просмотра на шести телевизионных платформах, а также на аудио- и цифровых выходах.На презентации BCS Megacast были представлены несколько личностей ESPN, а также приглашенные тренеры, игроки и знаменитости для освещения на ESPN, ESPN2, ESPNEWS, ESPN Radio, ESPN3, ESPN Classic, ESPN Deportes, ESPN Goal Line и ESPN International.

ESPNU представит на бис опцию «BCS Film Room» от ESPNEWS сегодня в 16:00. ET. В телепередаче приняли участие тренер Texas A&M Кевин Самлин, тренер Питта Пол Крист и тренер Бостонского колледжа Стив Аддацио, а также аналитики ESPN Мэтт Миллен, Крис Спилман и Том Лугинбилл, которые представили подробный X- и O-анализ игры, происходившей из кинозала. оснащен несколькими углами обзора камеры и сенсорными экранами.

-30-

LARA - Свяжитесь с отделом корпораций

Свяжитесь с отделом корпораций

Агентство: лицензирование и нормативно-правовые вопросы
Напишите нам по адресу [email protected]
Отдел Телефонный номер Номер факса
Деловые услуги 517-241-6470 517-241-0538
Обзор документа 517-241-6470
Товарные знаки 517-241-6470

Почтовый адрес

Улица Адрес:

Корпорации, ценные бумаги и коммерческое лицензирование
Подразделение корпораций
А / я 30054
Лансинг, Мичиган 48909

Корпорации, ценные бумаги и коммерческое лицензирование
1 этаж
2501 Вудлейк Круг
Окемос, MI 48864

Ночная почта

Бюро лицензирования корпораций, ценных бумаг и коммерции
Подразделение корпораций
2407 Н.Гранд Ривер авеню,
Лансинг, Мичиган 48906

* Ночная доставка документов и пакетов в штат Мичиган
почтовый центр и отправили нам.
Это может привести к тому, что мы доберемся до нашего офиса через день или больше.

BCS Community Credit Union | График комиссий

Акции Драфт Счета

Дата вступления в силу: пятница, 28 мая 2021 г.

Тип Комиссия
Плата за исследование аккаунта 20 долларов.00 / час
Комиссия за транзакцию через банкомат (после 10 бесплатных ежемесячных платежей) 1,00 доллар США
Платежи любезности (овердрассированный счет) 29,00 $
Комиссия за возврат депонированного товара 15,00 $
Дубликат выписки по почте / факсу за страницу 1,00 долл. США
Ежемесячная плата eChecking 10,00 долларов США
Плата за выписку в бумажном виде (ежемесячно, бесплатно для несовершеннолетних старше 65 лет) 3.00
Комиссия за замену пластиковой карты 8,00 $
Плата за возвращенный товар (ACH / общий черновик) 29,00 $
Проверки температуры (на страницу из 4 проверок) 4,00
Комиссия за прекращение выплаты 29,00 долларов США

Все счета

Дата вступления в силу: пятница, 28 мая 2021 г.

Тип Комиссия
Комиссия за закрытие счета (в течение 90 дней с момента открытия) 25 долларов США.00
Комиссия за исследование аккаунта (в час) 20,00
Комиссия за обналичивание чеков (без проверки и т. Д.) 5,00 долларов США
Комиссия за обналичивание чеков (не для участников, внутри нас) 7,00
Очищенная копия чека (бесплатно в интернет-банке)
Членство в организации Consumers United 5,00 долл. США
Плата за обработку уборки 50,00 долларов США
Комиссия за бездействие / бездействующий счет 10 долларов США.00 / в месяц
Выплата наличных в крупных размерах (требуется предварительный заказ) 20.00-40.00
Комиссия за крупный коммерческий депозит наличными 30,00 долларов США за 500 банкнот
Нарушение минимального баланса (минимальная доля в размере 5 долларов США) 10 долларов США в месяц
Обналичивание чеков внутри нас, не являющихся участниками (до 1500 долларов США) 7,00 долларов США
Официальная комиссия за проверку: Участник 3,00 долл. США
Официальная комиссия за проверку: для лиц, не являющихся участниками программы $ 7.00
Официальное изображение чека $ 2,00
Официальный чек Stop Payment (за исключением случаев) 35,00 $
Ночная почтовая оплата (оценочная) 39,00 $
Плата за возврат почты 5,00 долларов США
Общая комиссия за ветвление (после 3 бесплатных транзакций) 1,50 долл. США за транзакцию.
Комиссия за банковский перевод (входящий) 5,00 долларов США
Комиссия за банковский перевод (исходящий) 20 долларов США.00
* Только для остатка по акциям менее 100 долларов и без активного тратта, сертификатов или ссудных счетов.

Кредитные счета

Дата вступления в силу: пятница, 28 мая 2021 г.

Тип Комиссия
Плата за дублирование документа (за страницу) 1,00 долл. США
Добавочный номер / Skip-A-Payment 35,00 $
Сбор за регистрацию правового титула (ссуды на покупку транспортных средств) 20 долларов США.00
Годовая комиссия HELOC / LOC 15,00 долл. США
Комиссия за просрочку платежа (после 15-дневного льготного периода) 15,00
Комиссия за кредитный документ 50,00 долларов США
Комиссия онлайн-платежного центра (eCheck или карта) 5,00 долларов США
Оплата по телефону 10,00 долларов США
График погашения недвижимости 25,00 $
Выплата ссуды с возвратом (NSF) - Чек
или ACH
29 долларов.00

Руководство Тоскаравас | Государственный университет Кента

Основы лидерства
Заявка на участие в программе подписи Тускараваса на 2021-2022 годы

2021-2022 ОБЗОР КЛАССА ЛИДЕРСТВА TUSCARAWAS SIGNATURE

ВНИМАНИЕ: КЛАСС ЗАВЕРШЕН И РЕГИСТРАЦИЯ ЗАКРЫТА. ПОЖАЛУЙСТА, ЗВОНИТЕ 330-308-7437, ЧТОБЫ РАЗМЕСТИТЬ В СПИСОК ОЖИДАНИЯ

СПОНСОРЫ ПРОГРАММЫ

Мы по-прежнему пользуемся сильной поддержкой множества сторонников и друзей Leadership Tuscarawas.Мы искренне ценим их многолетнюю поддержку.

Среди сторонников конференции Signature Class и Leaders of Tomorrow 2020:

Adventure Property Holdings; Симона Болтерон; Bowerston Shale; Консультационный центр Хризалис; Госпиталь Кливлендской клиники; Кредитный союз Дувр-Фила; Первый федеральный банк сообщества; Первый национальный банк Деннисона; ООО "Инвестиционные партнеры"; Джефф Матиас и Говард Ханна; Киванис клуб Новой Филадельфии; Kraton Corporation; Аптека Medi-Wise; New Philadelphia Rotary; ProVia; Торгово-сберегательный банк; Городская больница Тринити; Triple S Energy; WJER; Союзное машиностроение и машиностроение; Марк Маккензи; Лютеранская церковь Грейс, Градалл, Центр карьеры Бакай, Государственный университет Кента в Тоскаравасе и Бюро конгрессов и посетителей округа Тоскаравас.

ОБЗОР ПРОГРАММЫ

В 2002 году усилиями Торговой палаты округа Тускаравас и Кентского государственного университета в Тускаравасе была сформирована программа лидерства для взрослых для округа Тускаравас.

Цель Лидерства Тускаравас - воспитывать страстных, дальновидных лидеров для укрепления сообщества. Участники со всего округа завершают программу Leadership Tuscarawas. Члены класса собираются на полный день один раз в месяц, с августа по май.

Программа начинается с ночного ретрита, где участники встречаются друг с другом, используют методы построения команды и исследуют свои личные стили лидерства и общения. Затем класс совершает однодневную автобусную экскурсию по округу и знакомится со многими проблемами, стоящими перед нашим сообществом.

Интерактивные занятия проводятся в разных местах в течение года программы и нацелены на навыки и такие вопросы, как решение проблем, управление конфликтами, опека сообщества, образование и экономическое развитие.Широкий спектр обсуждаемых тем позволяет участникам получить более глубокое представление о округе, его многочисленных проблемах и возможностях. Лидерство Tuscarawas также повышает осведомленность о различных организациях, работающих в округе, способствует развитию лидерских навыков и развитию, а также предоставляет возможность для установления контактов и взаимодействия с другими лидерами сообщества.

Каждый класс должен выполнить общественный проект, который будет представлен на выпускной церемонии в мае.

Заявление о приеме

Обратите внимание, что вы можете выйти из приложения и вернуться позже. Эта функция включена по умолчанию и работает путем размещения в вашем браузере файла cookie, который отслеживает ход выполнения приложения. По умолчанию у вас есть две недели, чтобы вернуться к опросу и закончить. Через две недели ваше заявление будет зарегистрировано как есть. Если по какой-либо причине вы не хотите сохранять свое приложение, вы всегда можете очистить историю браузера и начать заново.

Крайний срок подачи заявок и депозита (250 долларов США) - 9 июля. Все одобренные кандидаты будут уведомлены по электронной почте о своем принятии в класс.

Критерии отбора

При приеме на работу соискатели должны пользоваться полной поддержкой своего работодателя или контролирующей организации. Также могут подавать заявки лица, не связанные с бизнесом или организацией.

Участников предстоящего занятия по лидерству Тускаравас будут отобраны исполнительным директором и отборочной комиссией, состоящей из членов Совета по лидерству Тускаравас.

Приемная комиссия внимательно рассматривает все поступившие заявки. Комитет стремится отбирать людей, которые демонстрируют высокие стандарты личной честности, демонстрируют доказательства лидерского потенциала и приверженности общественным работам.

Класс ограничен до 30 участников. Кандидатам, которые не были отобраны, рекомендуется подать повторную заявку в последующие годы.

Стоимость обучения

Стоимость обучения составляет 1750 долларов за 10-месячную программу и включает в себя все учебные материалы, классную рубашку-поло, перерывы на освежающие напитки и обед каждый день.Депозит в размере 250 долларов необходимо внести при подаче заявления не позднее 9 июля. Оплата полной стоимости обучения требуется до 6 августа.

Ограниченные средства на обучение доступны до 500 долларов для кандидатов из некоммерческих, малых предприятий или государственных организаций. Те, кто запрашивает грант на обучение, должны подать запрос в Leadership Tuscarawas в письменной форме до крайнего срока подачи заявок 9 июля и предоставить достаточное обоснование, демонстрирующее финансовую потребность.

Правление Leadership Tuscarawas оставляет за собой право утвердить или отклонить любой запрос на получение помощи за обучение, ограничить сумму денежных средств, доступных для помощи за обучение, в зависимости от имеющихся финансовых ресурсов, а также пересмотреть руководство по помощи за обучение в любое время без предварительного уведомления.

Участие и обязательство по времени

Руководство Tuscarawas требует серьезных затрат времени и энергии. Все кандидаты должны соответствовать требованиям посещаемости. Необходимо полное участие каждого человека, и ожидается присутствие на каждом занятии.

В связи с тем, что могут возникнуть чрезвычайные ситуации или деловые потребности, участник может отсутствовать не более чем на 12 часов занятий. Участники, отсутствующие на занятиях более 12 часов, не могут закончить обучение в своем текущем классе.Пропущенные часы должны быть восполнены в следующем году для выпуска. Руководство Tuscarawas оставляет за собой право уведомить работодателя / спонсора участника курса, если он не соответствует требованиям посещаемости.

Посещение всего двухдневного ретрита по августовской программе является обязательным и не подлежит обсуждению. Участников класса, которые приняты в программу и не могут присутствовать на ретрите, попросят подождать до следующего года, чтобы войти в программу.

Ожидается, что

участников примут участие в вечерней церемонии вручения дипломов Leadership Tuscarawas Signature Class в Кентском государственном университете в Тоскаравасе.

Участники должны принять участие в общественном проекте, который может потребовать дополнительных временных затрат вне класса.

2021-2022 Leadership Tuscarawas Расписание программирования (может быть изменено)

26 и 27 августа 2021 г.

Открытие ночевки (обязательно) в Salt Fork Lodge, Кембридж, Огайо. Retreat ориентирован на ориентацию в классе и тренинг по развитию лидерских качеств.

14 сентября 2021 г.

Автобусный тур по округу Тоскаравас

окт.12, 2021

Отбор и начало классных проектов и тренинги по развитию лидерских качеств

9 ноября 2021 г.

Уголовное правосудие, нефтегазовая промышленность, туризм и тренинги по развитию лидерских качеств

14 декабря 2021 г.

Обучение исполнительскому и общественному искусству, здравоохранению и развитию лидерских качеств

11 января 2022 г.

Производство, трудовые ресурсы и экономическое развитие, основы работы с советами директоров и тренинги по развитию лидерских качеств

фев.8, 2022

Системы правосудия для взрослых и несовершеннолетних в округе Тускаравас, обед с советом директоров LT и тренинг по развитию лидерских качеств

8 марта 2022 г.

Сельское хозяйство, образование и тренинги по развитию лидерских качеств

12 апреля 2022 г.

Правительство, основы правления и тренинг по развитию лидерских качеств

10 мая 2022 г.

Тренинг по развитию лидерских качеств, презентации проектов и выпускные

Избранные темы развития лидерских качеств, проведенные в течение 10-месячной программы

  • Персональная и организационная эффективность
  • Оценка стиля личности
  • Мультисенсорное обучение
  • Зона вашего комфорта
  • Общие сведения об обслуживании платы (3 модуля)
  • Управление временем
  • Слуга лидерства
  • Межличностная и организационная эффективность
  • Улучшение коммуникации
  • Ведущее стратегическое изменение
  • Укрепление доверия и прозрачности
  • Понимание эмоционального интеллекта
  • Порядок достижения успеха
  • Влияние и убеждение
Важные даты

Заявление и депозит в размере 250 долларов США до 9 июля 2021 г.

Заявки уведомлены о приеме до 31 июля 2021 г.

Остаток платы за обучение должен быть оплачен до августа.6, 2021

За дополнительной информацией обращайтесь к доктору Уильяму (Биллу) Байзелю по телефону 330-308-7437 или [email protected]

Интравитреальная доставка нового вектора AAV нацелена на биполярные клетки и восстанавливает зрительную функцию в модели полной врожденной стационарной куриной слепоты у мышей | Молекулярная генетика человека

Аннотация

Аденоассоциированный вирус (AAV) эффективно воздействует на терапевтические гены фоторецепторов, пигментного эпителия, глии Мюллера и ганглиозных клеток сетчатки.На сегодняшний день никто не продемонстрировал способность исправлять с помощью замены генов врожденный дефект биполярных клеток (БК), возбуждающих интернейронов сетчатки. Нацеливание на BC с заменой гена было затруднено в первую очередь из-за относительной недоступности BC для стандартных векторов AAV. Этот подход может быть полезен для восстановления зрения у пациентов с полной врожденной стационарной куриной слепотой (CSNB1), когда передача сигналов через ON BC устраняется из-за мутаций в их каскадных генах, связанных с G-белками.Например, большинство пациентов с CSNB1 несут мутацию в никталопине ​​( NYX ), который кодирует белок, необходимый для правильной локализации катионного канала TRPM1, необходимого для вызванной светом деполяризации ON BC. Как группа, пациенты CSNB1 имеют нормальную электроретинограмму (ЭРГ) a-волну, указывающую на функцию фоторецепторов, но не имеют b-волны из-за дефектов передачи сигналов ON BC. Несмотря на дисфункцию сетчатки, сетчатка пациентов с CSNB1 не дегенерирует. Мышиная модель CSNB1 Nyx nob точно имитирует этот фенотип.Здесь мы показываем, что интравитреально введенный рационально сконструированный AAV2 (quadY-F + T-V), содержащий новый промотор «Ple155», управляет либо GFP, либо YFP_ Nyx у постнатальных мышей Nyx nob . В обработанной сетчатке Nyx nob устойчивая и нацеленная экспрессия трансгена Nyx в ON BC частично восстанавливала b-волну ERG и на клеточном уровне передачу сигналов в ON BC. Наши результаты подтверждают возможность доставки генов в РМЖ и генной заместительной терапии в человеческом CSNB1.

Введение

Биполярные клетки сетчатки ON (ON BC) деполяризуются в ответ на индуцированное светом снижение высвобождения глутамата фоторецептора и образуют первичный возбуждающий канал между фоторецепторами и ганглиозными клетками сетчатки (RGC). Мутации в генах, которые кодируют белки, участвующие в сигнальном каскаде, связанном с G-белком метаботропного глутаматного рецептора 6 ON BC (mGluR6), ответственны за различные формы полной врожденной стационарной куриной слепоты (CSNB1) (1).Пациенты с CSNB1 в раннем детстве имеют нарушение ночного зрения и могут быть диагностированы с помощью ERG, где они демонстрируют отчетливое отсутствие b-волны, управляемой ON BC, при сохранении нормальной а-волны фоторецептора (2). У пациентов с CSNB1 также наблюдаются другие фенотипы, включая тяжелую миопию, косоглазие и нистагм (3). Мышиные модели, несущие мутации в гомологичных генах CSNB1, таких как Grm 6 (4–8), неселективный катионный канал TRP меластатин 1 ( Trpm 1) (9–12), рецептор орфанного белка G ( Gpr 179) (13,14) и два белка с высоким содержанием лейцина, никталопин ( Nyx ) (15–17) и Lrit 3 (18,19), точно воспроизводят фенотип ERG без b-волны, наблюдаемый у пациентов CSNB1, и все вместе будут называться «nob» мышами.Все эти белки локализованы на кончиках дендритов ON BCs, и их мышиные модели были использованы для исследования роли каждого в каскаде mGluR6 (Fig. 1). Из этих исследований мы знаем, что в отсутствие света глутамат, высвобождаемый фоторецепторами, связывается с метаботропным mGluR6 (20,21) и активирует G-белок, G o (22,23). Хотя точная последовательность каскада остается неизвестной, ясно, что начальная стадия требует диссоциации субъединиц G-белка и завершается закрытием катионного канала TRPM1 (24–26).NYX необходим для правильной локализации TRPM1 (27), тогда как GPR179 обеспечивает чувствительность канала (28). LRIT3 также важен для правильной локализации TRPM1 (27,29,30). Несмотря на нарушение передачи сигналов ON BC, мутации в этих каскадных белках не влияют на морфологию сетчатки у пациентов с CSNB1 или соответствующих моделей мышей (1). Это говорит о том, что они являются хорошими кандидатами для заместительной генной терапии.

Рисунок 1.

Белки глутаматного каскада экспрессируются в кончиках дендритов ON BC.Глутамат, высвобождаемый из окончаний фоторецептора в темноте, связывает метаботропный глутаматный рецептор mGluR6 и активирует альфа-субъединицу гетеротримерного G-белка, Gα o . Диссоциация субъединиц G-белка завершается закрытием неизбирательного катионного канала TRPM1. Gα o инактивируется субъединицей β (β5) и GTPазой, активирующей регулятор сигнального комплекса G-белка. Богатый лейцином повторяющийся белок, NYX, необходим для правильной локализации TRPM1, тогда как GPR179, другой рецептор G-белка, опосредует чувствительность каналов.LRIT3 взаимодействует как с NYX, так и с TRPM1.

Рисунок 1.

Белки глутаматного каскада экспрессируются в кончиках дендритов ON BC. Глутамат, высвобождаемый из окончаний фоторецептора в темноте, связывает метаботропный глутаматный рецептор mGluR6 и активирует альфа-субъединицу гетеротримерного G-белка, Gα o . Диссоциация субъединиц G-белка завершается закрытием неизбирательного катионного канала TRPM1. Gα o инактивируется субъединицей β (β5) и GTPазой, активирующей регулятор сигнального комплекса G-белка.Богатый лейцином повторяющийся белок, NYX, необходим для правильной локализации TRPM1, тогда как GPR179, другой рецептор G-белка, опосредует чувствительность каналов. LRIT3 взаимодействует как с NYX, так и с TRPM1.

Аденоассоциированный вирус (AAV) продемонстрировал значительный успех как в клинических испытаниях наследственного заболевания сетчатки, так и во множестве экспериментальных экспериментов, подтверждающих концепцию (31–37). Пигментный эпителий сетчатки и фоторецепторы эффективно нацелены на различные серотипы AAV после доставки в субретинальное пространство.RGCs эффективно трансдуцируются после доставки в стекловидное тело (38,39). Трансдукция типов клеток внутреннего ядерного слоя (например, ON BC) в невырожденных сетчатках и селективная экспрессия трансгена в ON BC оказались сложной задачей. Это связано с неспособностью большинства серотипов AAV эффективно проникать в клетки внутренней сетчатки. На сегодняшний день AAV использовался только для доставки ксеногенных микробных опсинов, искусственного оптического переключателя на основе iGluR6 или датчиков света на основе меланопсина в ON BC, все с целью придания световой чувствительности нейронам второго порядка в моделях мышей, лишенных фоторецепторов (40–44).Во всех случаях экспрессия трансгена управлялась в ON BC с помощью энхансерной последовательности Grm6 , слитой с промотором SV40. Поскольку эти исследования были проведены на моделях грызунов, демонстрирующих развитую дегенерацию фоторецепторов, неясно, будет ли промотор Grm6 / SV40 пригоден для управления селективной экспрессией в ON BC в невырожденных стационарных моделях, таких как мыши nob .

С этой целью мы разработали новую комбинацию вектора AAV и клеточного промотора, способную управлять эффективной и направленной экспрессией трансгена в ON BC невырожденной сетчатки мыши после интравитреальной инъекции.Мы показываем, что AAV2 (quadY-F + T-V) -Ple155 опосредует экспрессию трансгена в ON BC и восстанавливает передачу сигналов ON BC в C57BL / 6J дикого типа (WT) и в модели CSNB1 у мышей Nyx nob . Это первая демонстрация того, что врожденный генетический дефект ON BC может быть исправлен с помощью генной терапии на основе AAV. Наши результаты имеют значение для разработки генной терапии для NYX и других форм CSNB1, а также для неинвазивных оптогенетических манипуляций с передачей сигналов ON BC.

Результаты

AAV2 (quadY-F + T-V) -Ple155 управляет устойчивой и целевой экспрессией трансгена в ON BC

Мы ранее идентифицировали вариант капсида на основе AAV2, способный трансдуктировать большинство клеток сетчатки после интравитреальной инъекции мыши (39). Мы объединили этот вариант с нашим недавно описанным человеческим MiniPromoter, Ple155, который способствует экспрессии трансгена в BC мышей с однокопией knock-in (45), и оценили его способность управлять экспрессией GFP в BC C57BL / 6J (WT). и Nyx nob мышей после субретинальной или интравитреальной инъекции (рис.2). В сетчатке взрослых мышей WT опосредованная AAV2 (quadY-F + T-V) -Ple155 экспрессия GFP была нацелена на BC. Трансдукция субретинальной доставкой была неэффективной (фиг. 2A) по сравнению с интравитреальной инъекцией в сетчатку WT или Nyx nob (фиг. 2B и C). Опосредованная AAV экспрессия GFP, совместно локализованная с протеинкиназой C-альфа (PKCα) (рис. 2A / C), маркером стержневых BC, а также белком 2 клеток Пуркинье (PCP2) (рис. 2B), маркером стержня и подмножество BC конуса ON и исходный ген для дизайна Ple155 MiniPromoter (45).Экспрессия GFP наблюдалась в средней сетчатке с флуоресценцией, локализованной на сомах и концах дендритов ON BC. GFP также был замечен в окончаниях аксонов ON BC и был отмечен в некоторых (хотя и очень немногих) RGC во внутренней сетчатке. Интравитреальная инъекция приводит к тому, что RGC подвергаются воздействию высокой концентрации векторных частиц. Даже промоторы, нацеленные на фоторецепторы, такие как GRK1, опосредуют «нецелевую» экспрессию GFP в RGC, когда они включены в векторы AAV, доставленные интравитреально с высоким титром (39).Экспрессия в ON BCs была широко распространена в сетчатке мышей, которым интравитреально инъецировали (Fig. 2D). В отличие от трансдукции, достигаемой с помощью вектора на основе AAV2, интравитреальная инъекция AAV8 (Y733F) -Ple155-GFP не способствовала трансдукции ON BC (дополнительный материал, рис. S1).

Рисунок 2.

AAV2 (quadY-F + TV) -Ple155-опосредованная экспрессия GFP (зеленый) ограничена ON BC, о чем свидетельствует совместное окрашивание либо палочковидным биполярным маркером PKCα ( A и C ), либо Маркер ON BC PCP2 ( B ) красного цвета.Только минимальная трансдукция была достигнута с помощью субретинальной инъекции (A), но устойчивая и нацеленная трансдукция ON BC наблюдалась после интравитреальной инъекции P30 как у мышей WT (B), так и у мышей Nyx nob (C). Панретинальная трансдукция ON BC наблюдалась после интравитреальной инъекции у обоих штаммов (WT показан в D ). SR = субретинальный, Ivt = интравитреальный, ONL = внешний ядерный слой, INL = внутренний ядерный слой, GCL = слой ганглиозных клеток. Масштабные линейки = 34 мкм (A – C) и 200 мкм (D).

Рисунок 2.

AAV2 (quadY-F + TV) -Ple155-опосредованная экспрессия GFP (зеленый) ограничена ON BC, о чем свидетельствует совместное окрашивание с помощью любого палочкообразного биполярного маркера PKCα ( A и C ) или ON BC маркер PCP2 ( B ) красного цвета. Только минимальная трансдукция была достигнута с помощью субретинальной инъекции (A), но устойчивая и нацеленная трансдукция ON BC наблюдалась после интравитреальной инъекции P30 как у мышей WT (B), так и у мышей Nyx nob (C). Панретинальная трансдукция ON BC наблюдалась после интравитреальной инъекции у обоих штаммов (WT показан в D ).SR = субретинальный, Ivt = интравитреальный, ONL = внешний ядерный слой, INL = внутренний ядерный слой, GCL = слой ганглиозных клеток. Масштабные линейки = 34 мкм (A – C) и 200 мкм (D).

Мы сравнили относительные способности Ple155 и ранее описанной комбинации энхансера / промотора Grm6 / SV40 управлять экспрессией трансгена исключительно в ON BC в недегенеративной сетчатке. AAV8 (Y733F) -Grm6 / SV40-hChR2-eGFP, доставленный субретинально мышам WT, стимулировал нецелевую экспрессию GFP главным образом в фоторецепторах (дополнительный материал, рис.S2) (40). Из-за его повышенной специфичности относительно Grm6 / SV40 в невырожденной сетчатке промотор Ple155 был включен во все дальнейшие эксперименты.

AAV2 (quadY-F + T-V) -Ple155, введенный интравитреально, восстанавливает экспрессию никталопина до

Nyx nob ON BC

Для разработки клинически значимого подхода мы исследовали паттерн экспрессии никталопина ( Nyx ) после послеродовой доставки с помощью нашего вектора AAV2 (quadY-F + T-V) -Ple155.Мы использовали идентичную гибридную кДНК YFP_ Nyx , использованную для создания трансгенной мыши, которая сохранила фенотип Nyx nob (46). Интравитреальная инъекция мышам P2 Nyx nob с AAV2 (quadY-F + TV) -Ple155-YFP_ Nyx (рис. 3) вызвала широко распространенную экспрессию YFP_NYX (рис. 3A) на дендритных концах ON BC ( Рис. 3B и C). Эти данные подтверждают сообщения о локализации NYX в синаптических сайтах (15,17,46–49). Также наблюдалась экспрессия AAV-опосредованного YFP_NYX в соме ON BC и окончаниях аксонов.Эти места, вероятно, являются эктопической экспрессией из-за сверхэкспрессии с помощью AAV в некоторых ON BC. Количество трансдуцированных ON BC на сетчатку, обработанную P2, определяли количественно относительно общего количества ON BC (определяемого коэкспрессией анти-PCP2) в репрезентативных поперечных срезах тремя независимыми наблюдателями. Средний процент трансдукции ON BC у мышей Nyx nob , обработанных P2, составил 21,5%. Интравитреальные инъекции мышам P30 WT и Nyx nob (рис.3D и E) производили целевую экспрессию в ON BC, хотя процент был заметно ниже по сравнению с инъекциями P2.

Рисунок 3.

Интравитреальная трансдукция AAV2 (quadY-F + T-V) -Ple155-YFP_ Nyx (зеленый, антитело GFP) ограничена ON BC (красный, антитело PKC). Широко распространенная трансдукция ON BC наблюдается в целых наглазниках мышей Nyx nob ( A ), инъецированных P2. Внутриглазная инъекция в P2 способствовала устойчивой трансдукции ON BC в обоих штаммах (показаны мыши Nyx nob ) ( B и C ).Большое увеличение (белое поле) показывает экспрессию YFP_NYX в телах клеток и кончиках дендритов ON BC (C). Минимальная экспрессия YFP_NYX наблюдалась после интравитреальной инъекции у мышей P30 WT или Nyx nob ( D и E ). ONL = внешний ядерный слой, INL = внутренний ядерный слой, GCL = слой ганглиозных клеток. Масштабные линейки = 17 мкм (A – D) и 200 мкм (E).

Рисунок 3.

Интравитреальное AAV2 (quadY-F + T-V) -Ple155-YFP_ Трансдукция Nyx (зеленый, антитело GFP) ограничивается ON BC (красный, антитело PKC).Широко распространенная трансдукция ON BC наблюдается в целых наглазниках мышей Nyx nob ( A ), инъецированных P2. Внутриглазная инъекция в P2 способствовала устойчивой трансдукции ON BC в обоих штаммах (показаны мыши Nyx nob ) ( B и C ). Большое увеличение (белое поле) показывает экспрессию YFP_NYX в телах клеток и кончиках дендритов ON BC (C). Минимальная экспрессия YFP_NYX наблюдалась после интравитреальной инъекции у мышей P30 WT или Nyx nob ( D и E ).ONL = внешний ядерный слой, INL = внутренний ядерный слой, GCL = слой ганглиозных клеток. Масштабные линейки = 17 мкм (A – D) и 200 мкм (E).

Замена гена никталопина у мышей

Nyx nob частично восстанавливает b-волну электроретинограммы (ЭРГ)

Мы оценили степень ON BC функции во всей сетчатке с помощью ERG. У мышей Nyx nob , получавших лечение на P2, ERG регистрировались на P32. Реакции b-волны ERG для глаз, которым вводили AAV2 (quadY-F + T-V) -Ple155-YFP_ Nyx , сравнивали с необработанными контралатеральными глазами или глазами, которым вводили контрольный вектор AAV2 (quadY-F + T-V) -Ple155-GFP.Адаптированные к темноте ЭРГ-ответы, зарегистрированные для необработанных контрольных глаз Nyx nob (рис. 4Ai, красные кривые), были идентичны предыдущим отчетам (16,46). Эти ERG имели общую отрицательную полярность. Для сравнения, адаптированные к темноте ERG-ответы во всех обработанных P2 AAV глазах Nyx nob имели четкий положительный компонент (фиг. 4Ai, черные контуры). Стрелки указывают компоненты ответа ERG, восстановленные обработкой AAV. Эти данные отражают спасение передачи сигналов через стержневые BC BC.Спасение было легче всего увидеть в ответ на стимулы низкой яркости (например, от -3,6 до -2,4 log кд / м 2 ), где необработанная Nyx nob ERG по существу плоская. Рисунок 4B суммирует величину спасения адаптированной к темноте b-волны к стимулу −2,4 log кд · с / м 2 . Не было измеряемого ответа b-волны от необработанных или обработанных AAV-GFP глаз (фиг. 4B). Улучшения ERG были значительными ( P <0,000001). Как и следовало ожидать из ограниченной экспрессии у мышей Nyx nob , которым инъецировали AAV2 (quadY-F + TV) -Ple155-YFP_ Nyx на P30, мы не обнаружили спасения их b-волны ERG (данные не показаны , n = 5 сетчаток).

Рисунок 4.

Электроретинографический анализ мышей AAV2 (quadY-F + TV) -Ple155-YFP_ Nyx , обработанных AAV2 (quadY-F + TV) -Ple155-GFP и необработанных Nyx nob мышей . Типичные адаптированные к темноте ( A, , слева) и адаптированные к свету (A, справа) ERG, полученные из двух глаз отдельной мыши. Красные следы были записаны от необработанного глаза, в то время как черные следы были записаны от глаза, в который был введен AAV-YFP_ Nyx .Обратите внимание на наличие положительного сигнала (стрелки) в обработанных ответах, которого не было в ответах, полученных от необработанного глаза. Значения справа от каждой пары сигналов указывают яркость стробоскопической вспышки в логарифмах кд сек / м 2 . Средний положительный ответ, измеренный через 100 мс после предъявления стимула от AAV-YFP_ Nyx (черный) и необработанных (красных) глаз на стимул -2,4 log кд сек / м 2 ( B ). Левая и правая пары полосок сравнивают ответы глаз, обработанных AAV-YFP_ , Nyx и AAV-GFP, соответственно.Планки погрешностей показывают стандартную ошибку среднего. Div = деление.

Рисунок 4.

Электроретинографический анализ AAV2 (quadY-F + TV) -Ple155-YFP_ Nyx -обработанный, AAV2 (quadY-F + TV) -Ple155-GFP-обработанный и необработанный Nyx nob мышей. Типичные адаптированные к темноте ( A, , слева) и адаптированные к свету (A, справа) ERG, полученные из двух глаз отдельной мыши. Красные следы были записаны от необработанного глаза, в то время как черные следы были записаны от глаза, в который был введен AAV-YFP_ Nyx .Обратите внимание на наличие положительного сигнала (стрелки) в обработанных ответах, которого не было в ответах, полученных от необработанного глаза. Значения справа от каждой пары сигналов указывают яркость стробоскопической вспышки в логарифмах кд сек / м 2 . Средний положительный ответ, измеренный через 100 мс после предъявления стимула от AAV-YFP_ Nyx (черный) и необработанных (красных) глаз на стимул -2,4 log кд сек / м 2 ( B ). Левая и правая пары полосок сравнивают ответы глаз, обработанных AAV-YFP_ , Nyx и AAV-GFP, соответственно.Планки погрешностей показывают стандартную ошибку среднего. Div = деление.

Ответы, адаптированные к темноте, показывают, что лечение AAV восстановило функцию стержневых ON BC. Чтобы определить, были ли затронуты BC конуса ON аналогичным образом, мы записали адаптированные к свету ERG со стимулами, наложенными на устойчивое десенсибилизирующее поле стержня. Опять же, ЭРГ колбочек, записанные для Nyx nob контрольных глаз, были идентичны предыдущим отчетам (16,46,50). Рисунок 4Aii иллюстрирует адаптированные к свету ответы ERG от мыши с большим эффектом спасения.Стрелки снова указывают на компонент ответа, восстановленный обработкой AAV. Как и в примере, ERG в глазах, обработанных AAV, включали компоненты, которые напоминали WT, включая «отклонение» формы волны (колебательный потенциал). На необработанных глазах ничего из этого не наблюдалось. Наконец, величина адаптированной к свету ЭРГ коррелировала с величиной адаптированной к темноте b-волны ( r = 0,92).

Замена гена восстанавливает локализацию TRPM1 на кончиках дендритов ON BC и полностью устраняет стробирование канала TRPM1 ON BC

Ранее мы показали, что экспрессия TRPM1 теряется у мышей Nyx nob (27).Хотя функция NYX все еще не полностью изучена, очевидно, что необходимо локализовать TRPM1 на мембране кончиков дендритов ON BC. Экспрессия YFP_NYX и TRPM1 (фиг. 5) в сетчатке целиком от обработанной AAV мыши Nyx nob показывает, что многие BC ON, которые экспрессируют YFP_NYX (зеленый), также экспрессируют TRPM1 (красный). Как ранее отмечалось для TRPM1, экспрессия обнаруживается как в телах клеток ON BC, так и на их дендритных концах (Fig. 5A). Коэкспрессия заметна в одиночных ON BC (рис.5B) с устойчивым выражением YFP_NYX и TRPM1.

Рисунок 5.

Локализация TRPM1 восстанавливается на мембранах кончиков дендритов ON BC у обработанных мышей Nyx nob . Вид сверху обработанной сетчатки, показывающий TRPM1 (красный) и YFP_NYX (зеленый, антитело GFP) в телах клеток ( A , верхний ряд) и кончиках дендритов (A, средний ряд). Совместная локализация кончиков дендритов также показана на поперечном сечении сетчатки (A, нижний ряд) и на типичном ON BC при большом увеличении ( B ).OPL = внешний плексиформный слой, INL = внутренний ядерный слой. Масштабные линейки = 10 мкм (A) и 5 ​​мкм (B).

Рисунок 5.

Локализация TRPM1 восстанавливается на мембранах кончиков дендритов ON BC у обработанных мышей Nyx nob . Вид сверху обработанной сетчатки, показывающий TRPM1 (красный) и YFP_NYX (зеленый, антитело GFP) в телах клеток ( A , верхний ряд) и кончиках дендритов (A, средний ряд). Совместная локализация кончиков дендритов также показана на поперечном сечении сетчатки (A, нижний ряд) и на типичном ON BC при большом увеличении ( B ).OPL = внешний плексиформный слой, INL = внутренний ядерный слой. Масштабные линейки = 10 мкм (A) и 5 ​​мкм (B).

ON BC, экспрессирующие YFP_NYX, были нацелены на срезы сетчатки для регистрации патч-кламп целых клеток и впоследствии заполнены сульфородамином для морфологической идентификации (фиг. 6A). Экзогенное применение капсаицина, который непосредственно блокирует канал TRPM1, приводило к устойчивым выходным токам в обработанных WT и AAV Nyx nob стержневых ON BCs (фиг. 6B). Напротив, только небольшой ток наружу был вызван в Nyx nob стержневых ON BC без экспрессии YFP_NYX (рис.6Б). Этот выходной ток аналогичен остаточным токам, зарегистрированным в Trpm1 - / - ON стержневых БК (28). Сводные данные показывают, что амплитуды ответа стержневых BC Nyx nob , экспрессирующих AAV-опосредованный YFP_NYX, аналогичны WT и значительно отличаются от стержневых BC стержневых ON без YFP_NYX, некоторые из которых были зарегистрированы в тех же сетчатках (рис. 6C). ).

Рисунок 6.

ON Передача сигналов BC восстанавливается после обработки AAV у мышей Nyx nob .Репрезентативный стержень BC, экспрессирующий AAV-опосредованный YFP_NYX и правильно локализованный TRPM1, был нацелен для записи патч-кламп целой клетки и заполнен сульфородамином B ( A ). Капсаицин (10 мкМ), агонист TRPM1, наносили на дендриты стержня BC, чтобы закрыть отверстие канала TRPM1. В удерживайте = 50 мВ. Репрезентативные записи тока для BC стержня WT, обработанного AAV и необработанного BC стержня от Nyx nob мышей показывают полное восстановление передачи сигналов ON BC после лечения ( B ).Капсаицин распыляли на стержневые дендриты BC в течение 200 мс и 1 с. Текущие ответы были записаны для каждой ячейки, а затем усреднены ( C ).

Рисунок 6.

Передача сигналов ON BC восстанавливается после обработки AAV у мышей Nyx nob . Репрезентативный стержень BC, экспрессирующий AAV-опосредованный YFP_NYX и правильно локализованный TRPM1, был нацелен для записи патч-кламп целой клетки и заполнен сульфородамином B ( A ). Капсаицин (10 мкМ), агонист TRPM1, наносили на дендриты стержня BC, чтобы закрыть отверстие канала TRPM1. В удерживайте = 50 мВ. Репрезентативные записи тока для BC стержня WT, обработанного AAV и необработанного BC стержня от Nyx nob мышей показывают полное восстановление передачи сигналов ON BC после лечения ( B ). Капсаицин распыляли на стержневые дендриты BC в течение 200 мс и 1 с. Текущие ответы были записаны для каждой ячейки, а затем усреднены ( C ).

AAV-опосредованный транскрипт

Nyx присутствует у обработанных мышей

Для определения относительного уровня AAV-опосредованного транскрипта YFP_ Nyx у мышей Nyx nob , получавших раннюю (P2) и позднюю (P30) терапию, мы провели количественную полимеразную цепную реакцию обратной транскриптазы (qRT-PCR) на РНК экстрагировали из обработанных P2 и P30 сетчаток Nyx nob , а также из неинъектированных контролей соответствующего возраста (сетчатки извлекали через 30 дней после инъекции).Праймеры были сконструированы так, чтобы фланкировать ген 3 ' Nyx и сигнал полиА 5' SV40 со связыванием зонда в пределах первой четверти ампликона (таблица 1). Полимеразная цепная реакция (ПЦР) дала ампликон подходящего размера в сетчатке Nyx nob , обработанной AAV, но не в необработанной сетчатке Nyx nob или C57BL / 6J, как ожидалось (данные не показаны). AAV-опосредованный транскрипт YFP_ Nyx присутствовал в сетчатке, инъецированной как P2, так и P30, и был нормализован до Gapdh для сравнения (рис.7). Несмотря на относительно низкое количество ON BC, экспрессирующих YFP_NYX у мышей, получавших P30 (фиг. 3), транскрипт YFP_ Nyx был относительно более распространенным у P30-обработанных мышей Nyx nob , получавших P2 (фиг. 7). Присутствие транскрипта в образце, обработанном P30, предполагает эффективную доставку трансгена и что препятствие на пути к достижению устойчивой экспрессии NYX у обработанных P30 мышей Nyx nob , вероятно, возникнет после транскрипции.

3

3 3 .

3

3 3 .

3

3 3 .
Название праймера . Последовательность 5 '- 3' . +
GAPDH ВПЕРЕД AATGGTGAAGGTCGGTGTG
GAPDH REV GTGGAGTCATACTGGAACATGTAG
GAPDH зондом 6-FAM / TGCAAATGG / ДЗЭН / CAGCCCTGGTG / 3IABkFQ
ААВ-NYX ВПЕРЕД CCATGCAGTGATGGTCTT
AAV-NYX REV CATCAAGTACTTATCATGTCTGG
Датчик AAV-NYX 6-FAM / TCTTCACCT / ZEN / CTTGCGTCTTGCTCA / 3IABkFQ
Последовательность 5 '- 3' . +
GAPDH ВПЕРЕД AATGGTGAAGGTCGGTGTG
GAPDH REV GTGGAGTCATACTGGAACATGTAG
GAPDH зондом 6-FAM / TGCAAATGG / ДЗЭН / CAGCCCTGGTG / 3IABkFQ
ААВ-NYX ВПЕРЕД CCATGCAGTGATGGTCTT
AAV-NYX REV CATCAAGTACTTATCATGTCTGG
Датчик AAV-NYX 6-FAM / TCTTCACCT / ZEN / CTTGCGTCTTGCTCA / 3IABkFQ
Последовательность 5 '- 3' . +
GAPDH ВПЕРЕД AATGGTGAAGGTCGGTGTG
GAPDH REV GTGGAGTCATACTGGAACATGTAG
GAPDH зондом 6-FAM / TGCAAATGG / ДЗЭН / CAGCCCTGGTG / 3IABkFQ
ААВ-NYX ВПЕРЕД CCATGCAGTGATGGTCTT
AAV-NYX REV CATCAAGTACTTATCATGTCTGG
Датчик AAV-NYX 6-FAM / TCTTCACCT / ZEN / CTTGCGTCTTGCTCA / 3IABkFQ
Последовательность 5 '- 3' . +
GAPDH ВПЕРЕД AATGGTGAAGGTCGGTGTG
GAPDH REV GTGGAGTCATACTGGAACATGTAG
GAPDH зондом 6-FAM / TGCAAATGG / ДЗЭН / CAGCCCTGGTG / 3IABkFQ
ААВ-NYX ВПЕРЕД CCATGCAGTGATGGTCTT
AAV-NYX REV CATCAAGTACTTATCATGTCTGG
Датчик AAV-NYX 6-FAM / TCTTCACCT / ZEN / CTTGCGTCTTGCTCA / 3IABkFQ

Рисунок 7.

мРНК YFP_NYX обнаруживается в экстрактах сетчатки как в ранней (P2), так и в поздней (P30) обработке Nyx nob с помощью qRT-PCR. Стандартные отклонения были рассчитаны по трем повторным реакциям, проведенным для каждого образца.

Рис. 7.

мРНК YFP_NYX обнаруживается как в раннем (P2), так и в позднем (P30) обработанном экстракте сетчатки Nyx nob с помощью qRT-PCR. Стандартные отклонения были рассчитаны по трем повторным реакциям, проведенным для каждого образца.

Обсуждение

Скоординированное взаимодействие белков внутри каскада mGluR6 / GRM6 обеспечивает поддержание функционального фоторецептора для ON биполярного синапса (рис. 1). Связывание глутамата с GRM6 в темноте держит катионный канал TRPM1 закрытым. В ответ на свет снова открываются каналы TRPM1, вызывая деполяризацию ON BC и формирование b-волны ERG. Правильная локализация TRPM1 на мембране кончика дендрита зависит от экспрессии NYX, хотя белок TRPM1 остается экспрессированным в сомах ON BC мышей Nyx nob (27,29).Хотя существуют противоречивые данные, экспрессия TRPM1 также может требовать экспрессии GRM6 (7,29). Наконец, отсутствие LRIT3 также приводит к отсутствию TRPM1 в кончиках дендритов (30), но неизвестно, является ли это прямым следствием или результатом изменения экспрессии NYX.

Наше открытие, что AAV2 (quadY-F + T-V) -Ple155-опосредованная экспрессия YFP_NYX восстанавливала экспрессию TRPM1 в мембране кончиков дендритов ON BC у мышей Nyx nob , обработанных AAV, согласуется с предыдущими результатами (46).Кроме того, мы показываем, что это восстановление правильно локализованного TRPM1 на дендритных концах стержневых BCs соответствует полному восстановлению ответа стержня BC на агонист TRPM1, капсаицин. На уровне полного ответа сетчатки опосредованная AAV2 (quadY-F + T-V) -Ple155 экспрессия YFP_NYX частично восстанавливает b-волну ERG у обработанных мышей Nyx nob . Средняя амплитуда b-волны в глазах, обработанных P2, составляла ~ 40 мкВ, тогда как соответствующие возрасту ответы C57BL / 6J равнялись ~ 675 мкВ (51). Тот факт, что мы наблюдали полное восстановление амплитуд одноклеточного ответа, согласуется с нашими иммуногистологическими результатами, согласно которым около 22% ON BC экспрессировали AAV-опосредованный YFP_NYX.Взятые вместе, данные показывают, что подмножество инфицированных клеток ON BC ответственны за b-волновой ответ.

Ранняя (P2) и поздняя (P30) интравитреальная инъекция AAV2 (quadY-F + T-V) -Ple155 опосредует устойчивую и целевую экспрессию GFP у мышей WT и Nyx nob . Напротив, только ранняя инъекция эффективно стимулирует экспрессию NYX в обоих штаммах. Неудивительно, что b-волна ERG не восстанавливалась у мышей Nyx nob после позднего лечения (данные не показаны).Обработка на P5 способствовала относительно меньшей экспрессии, чем наблюдаемая после обработки P2 с ~ 3% ON BC, экспрессирующими YFP_NYX (данные не показаны). Эти результаты позволяют предположить, что добавление трансгена, специфичного для ON BC, наиболее эффективно при доставке, в то время как BC все еще дифференцируются (52,53).

Существует несколько возможных причин, по которым трудно экспрессировать NYX у мышей, получавших P30. Исследования оптогенетической экспрессии белков с использованием интравитреальной инъекции требуют вируса с очень высоким титром (41–44) для получения широко распространенной инфекции ON BC.Действительно, мы наблюдали, что терапевтические эффекты были достигнуты, когда вектор доставлялся при 2,5 × 10 13 мкг / мл, но не при 3,8 × 10 12 мкг / мл (данные не показаны). Таким образом, может потребоваться больше вирусных частиц, чтобы пройти через барьеры внутренней ограничивающей мембраны и плексиформных слоев для достижения достаточной трансдукции во внутреннем ядерном слое. Однако тот факт, что AAV-опосредованное сообщение Nyx присутствовало в сетчатке, инъецированной либо в P2, либо в P30, предполагает, что неэффективное нацеливание трансгена на ON BC не является причиной.Действительно, уровни транскриптов были выше у мышей, получавших P30, что, по крайней мере, частично объясняется большим количеством ON BC, доступных для трансдукции в полностью дифференцированной сетчатке P30 грызунов (52,53). Кроме того, сильная экспрессия GFP, опосредованная AAV2 (quadY-F + T-V) -Ple155, была достигнута после инъекции на P30. Это предполагает, что AAV2 (quadY-F + T-V) эффективно трансдуцировал ON BC в обоих возрастах, промотор Ple155 был активен и что препятствие на пути к достижению эффективной экспрессии / терапии NYX у старых мышей может быть посттранскрипционным.

Исходя из наших результатов, становится ясно, что необходимо проделать большую работу, чтобы превратить эту стратегию в клинически переводимую терапию. Интересно подумать, можно ли расширить окно терапии и разрешит ли лечение, раннее или позднее, другие фенотипы, сопровождающие CSNB1. Хорошо известно, что визуальный опыт может влиять на синаптическую функцию (54). Напр., Темное выступление нарушает локализацию GRM6 на кончиках дендритов конуса ON BC (55). Отсутствие функционального пути ON также влияет на развитие глаз, что приводит к миопии высокой степени у пациентов с CSNB1 (3) и повышенной восприимчивости к миопии с депривацией формы на моделях мышей с дефектами пути ON (56, 57), фенотип, предположительно являющийся результатом уменьшения метаболизм / обмен дофамина в сетчатке (56,57).Дефекты пути ON также приводят к снижению контрастной чувствительности и селективности кортикальной ориентации (58). Взятые вместе, возникает соблазн предположить, что экспрессия белков ON BC, таких как NYX, регулируется в процессе развития на трансляционном или посттрансляционном уровне.

В заключение, это исследование впервые показывает, что постнатальная доставка ON BC-специфического гена через AAV способна восстанавливать передачу сигналов ON BC в мышиной модели CSNB1. Однако необходимы дальнейшие улучшения, чтобы расширить терапевтическое окно.

Материалы и методы

Разработка и изготовление мини-промотора «Ple155»

Методы обзора по дизайну промотора Плеяд были опубликованы ранее (59). Для гена PCP2 MiniPromoter длиной 1652 п.н. был получен из двух альтернативных промоторов, которые аннотированы в браузере генома UCSC (версия GRCh48 / hg38). Последовательность базального промотора (Prom1) генерирует вариант транскрипта 1. Последующий альтернативный промотор (Prom2), расположенный в интроне 1 варианта транскрипта 1, генерирует вариант транскрипта 2.Чтобы избежать конфликта двух стартовых сайтов транскрипции, к последовательности Prom2 добавляли 5'-угол последовательности Prom1 в обратной ориентации от естественной геномной конфигурации. Экспрессия в глазу и головном мозге мышей, содержащих Ple155, управляющих lacZ , была охарактеризована ранее (45).

Праймеры

для ПЦР были сконструированы для амплификации выбранных регуляторных областей (таблица 2). Вкратце, геномную ДНК человека амплифицировали с использованием PCP-X_OL_V1 и PCP2-X_OR_V1, получая непрерывный продукт ПЦР размером 4500 п.н., содержащий все интересующие регуляторные области.Для создания Ple155 MiniPromoter две меньшие области были дополнительно амплифицированы и продукт ПЦР слияния был получен следующим образом. Используя исходный продукт ПЦР размером 4500 п.н., праймеры PCP2-ABD_P1R_MluI_V1 и PCP2-BD_P1L_V1 использовали для амплификации области Prom1. Праймеры PCP2-B_P2R_V1 и PCP2-B_P2L_SacI_V1 использовали для создания области Prom2. Впоследствии оба продукта ПЦР Prom использовали вместе с праймерами PCP2-ABD_P1R_MluI_V1 и PCP-2B_P2L_SacI_V1 для создания продукта ПЦР слияния, содержащего весь MiniPromoter, который был субклонирован с использованием Mlu I / Sac I сайтов в нескольких сайтах клонирования. вектор каркаса pEMS1313 (59) с получением плазмиды pEMS1626 (45).Дополнительная информация и конструкции доступны в AddGene (www.addgene.org).

Таблица 2. Праймеры для ПЦР

для дизайна Ple155 MiniPromoter

TCGAP2-B_P2L_Sac1473_V25 _Sac116_V25 _Sac116_V25 . TCGAP2-B_P2L_SacI_VG .

Праймеры для ПЦР для Ple155 MiniPromoter design

Название праймера . Последовательность a .
PCP2-X_OL_V1 TTATTTGAAATGGGGTTAGTATAGA
PCP2-X_OR_V1 TGCCATTCCAGATGATAATCTA
PCP2-ABD_P1R_MluI_V1 ACGT ACGCGT TGGACTCCAGTCACTTTTC
PCP2-BD_P1L_V1 GGACACTTCATTGGCATAG
PCP2-B_P2R_V1 TATGCCAATGAAGTGTCC GGATCAGGAGGAGAAGAC
PCGAP2-B_P2L_Sac1473_V25 Последовательность a . +
PCP2-X_OL_V1 TTATTTGAAATGGGGTTAGTATAGA
PCP2-X_OR_V1 TGCCATTCCAGATGATAATCTA
PCP2-ABD_P1R_MluI_V1 ACGT ACGCGT TGGACTCCAGTCACTTTTC
PCP2-BD_P1L_V1 GGACACTTCATTGGCATAG
PCP2-B_P2R_V1 TATGCCAATGAAGTGTCC GGATCAGGAGGAGAAGAC
PCGAP2-B_P2L
TCGAP2-B_P2L_SacI_VG
TCGAP2-B_P2L_Sac1473_V25 _Sac116_V25 _Sac116_V25 . TCAVCA_SAC116_VGAGC _Sac116_V1

Рекомбинантные векторные плазмиды AAV, содержащие Ple155-GFP и Ple155-YFP_NYX, были сконструированы следующим образом.NYX, слитый с усиленным YFP (YFP_NYX), амплифицировали с помощью ПЦР из исходного трансгенного клона prGABAcp1-YFP_NYX-rb456 (46). Затем его вставляли в вектор для субклонирования и полностью секвенировали. Затем фрагмент YFP_NYX клонировали в pTR-mGrm6 / SV40-hChR2_GFP, как описано у Dorodouchi et al . (40), используя рестрикционные ферменты Hind III и Not I. Оттуда YFP_NYX был перемещен через сайт рестрикции Eag I в pTR-UF-SB (60) для генерации pTR-CBA-YFP_NYX. Для создания pTR-Ple155-YFP_NYX плазмиду CBA затем расщепляли Not I и полученный фрагмент YFP_NYX клонировали в pTR-Ple155-GFP, в результате чего получали pTR-Ple155-YFP_NYX.pTR-Ple155-YFP_NYX и pTR-Ple155-GFP были упакованы либо в AAV2 (quadY-F + T-V), либо в AAV8 (Y733F). Кроме того, использовали pTR-mGrm6 / SV40-hChR2_GFP, упакованный в AAV8 (Y733F) (40). Все векторы были упакованы, очищены и титрованы согласно ранее опубликованным методам (61,62). Полученные титры каждого вируса были следующими: AAV2 (quadY-F + T-V) Ple155-hGFP, 4,8 × 10 13 об / мл; AAV2 (quadY-F + T-V) Ple155-YFP_NYX, 2,5 × 10 13 вг / мл; AAV8 (Y733F) -Ple155-hGFP, 1,2 × 10 13 мкг / мл; и AAV8 (733) -Grm6 / SV40-hChr2-GFP, 2.9 × 10 12 .

Животные и инъекционные методы

C57BL / 6J (приобретено в Jackson Laboratory) и Nyx nob мышей на фоне C57BL / 6J обрабатывали в соответствии с положением об использовании животных в офтальмологических и зрительных исследованиях Ассоциации исследований в области зрения и офтальмологии и руководящие принципы институциональных комитетов по уходу за животными и их использованию в Университете Флориды, Университете Луисвилля и клинике Кливленда.За час до инъекций P30 глаза расширяли 1% атропином, а затем 2,5% фенилэфрином (оба Akorn, Inc., Lake Forest, IL). Затем мышей анестезировали кетамином (72 мг / кг) / ксилазином (4 мг / кг) (Phoenix Pharmaceutical, Сент-Джозеф, Миссури). Транскорнеальные субретинальные инъекции вируса (1 мкл) выполняли с использованием тупой иглы 33-го размера на шприце Гамильтона. Транссклеральные интравитреальные инъекции (1 мкл) выполняли с помощью иглы со скошенной кромкой 33 размера на шприце Гамильтона. Мышей P2 анестезировали на льду, и вирус вводили внутриглазно (0.5 мкл) с помощью иглы со скошенной кромкой 34 размера на шприце Hamilton. Векторы доставлялись неразбавленными во всех случаях.

Электроретинограмма

После адаптации к темноте в течение ночи мышей анестезировали раствором кетамина (80 мг / кг) и ксилазина (16 мг / кг). Глазные капли использовались для расширения зрачков (1% тропикамид и 2,5% фенилэфрина HCl) и для обезболивания поверхности роговицы (1% пропаракаин HCl). Пара проволочных электродов из нержавеющей стали использовалась для записи ЭРГ с каждой поверхности роговицы.Эти активные отведения были привязаны к игольчатому электроду, помещенному в щеку. Второй игольчатый электрод, помещенный в хвост, служил заземляющим проводом. ERG регистрировали с помощью системы усреднения сигналов LKC (Gaithersburg, MD) UTAS E-3000. Ответы, вызванные стимулами стробоскопической вспышки Ганцфельда, подвергались полосовой фильтрации (0,03–1000 Гц), усиливались, усреднялись и сохранялись.

Nyx nob ERG состоит в основном из компонентов ответа, генерируемых фоторецепторами (a-волна), глиальными клетками Мюллера (медленный PIII) и гиперполяризующими BC (50), но в нем отсутствует компонент положительной полярности, генерируемый деполяризующими BC. (DBC) (16).Поскольку мы не были уверены, как AAV может повлиять на форму волны ERG обработанных мышей, мы повторили определенные условия стимула несколько раз для каждой мыши, чтобы мы могли оценить последовательное изменение формы волны. За этим исключением протокол записи был сопоставим с протоколом, используемым для других моделей мышей. В каждом сеансе записи мы начинали с адаптированных к темноте ответов на стимулы с низкой яркостью и увеличивали яркость вспышки по мере продолжения сеанса. Стимулы предъявлялись в порядке увеличения яркости и варьировались по яркости вспышки от –3.От 6 до 2,1 лог кд с / м 2 . После завершения записи, адаптированной к темноте, конусные ERG выделяли путем наложения стимулов на устойчивое адаптирующееся поле (20 кд / м 2 ). Яркость вспышки составляла от -0,8 до 1,9 log кд / м 2 . Все мыши Nyx nob , которым интраокулярно инъецировали в P2 AAV- Nyx ( n = 17), анализировали с помощью ERG.

Подготовка тканей, иммуногистохимия и микроскопия

Через четыре недели после инъекции конечности обработанных и необработанных глаз Nyx nob были помечены чернилами в положении «12 часов» для облегчения ориентации.Их немедленно энуклеировали, перфорировали иглой через роговицу и хранили в течение ночи при 4 ° C в 4% параформальдегиде. Роговицу и хрусталик удаляли, и наглазник инкубировали в 30% растворе сахарозы в течение ~ 3 часов при 4 ° C перед криозащищением в среде с оптимальной температурой резки (Sakura Finetek USA, Inc., Торранс, Калифорния). Срезы размером двенадцать микрон вырезали с использованием криостата Leica (Leica CM3050 S, Wetzlar, Германия) и хранили при -20 ° C. Срезы сетчатки подвергали иммуноокрашиванию по ранее описанным методикам (63).Вкратце, срезы доводили до комнатной температуры, промывали 1 × фосфатно-солевым буфером (PBS), блокировали 0,5% Triton-X100 и 1% бычьим сывороточным альбумином (BSA) в течение 1 ч каждый и затем инкубировали в течение ночи при 4 ° C первичные антитела в 3% тритоне + 1% БСА. Первичные антитела включали кроличьи поликлональные анти-GFP, которые также маркируют YFP (1: 1000, предоставлено доктором Клэем Смитом), мышиные моноклональные анти-PKCα 1: 200 (Санта-Крус, Даллас, Техас) или 1: 500 анти-PCP2 ( Санта Круз). После инкубации с первичным антителом предметные стекла промывали 1 × PBS, а затем инкубировали при комнатной температуре в течение 1 ч с соответствующими вторичными антителами Alexa Fluor (1: 500) в 1 × PBS (Invitrogen, Юджин, Орегон).Затем предметные стекла ополаскивали 1 × PBS, наносили на 4 ', 6-диамидино-2-фенилиндол (DAPI) -содержащую монтажную среду SlowFade (Thermo Fisher Scientific, Waltham, MA) и закрывали покровными стеклами. Изображения с большим увеличением (20 × или 40 ×) получали с помощью конфокальной микроскопии с вращающимся диском (микроскоп Nikon Eclipse TE2000, оснащенный модульной лазерной системой Perkin Elmer Ultraview и камерой Hamamatsu O-RCA-R2). Плиточные изображения (10 ×) наглазников получали с помощью флуоресцентного микроскопа Keyence BZ-900E. Подсчет клеток проводился на 40-кратных изображениях, взятых из четырех идентичных мест в наглазниках, содержащих зрительный нерв.Были отобраны более высокие, верхние / центральные, нижние / центральные и гораздо более низкие области.

Кусочки сетчатки, которые не были разрезаны для записи патч-кламп, инкубировали в 4% параформальдегиде в течение 20 мин. Сразу после завершения экспериментов с патч-зажимом срезы сетчатки инкубировали в 4% параформальдегиде в течение 20 минут при комнатной температуре. Затем кусочки сетчатки промывали 1 × PBS (3 × 5 мин), инкубировали в блокирующем растворе (0,5% Triton-X100 и 10% нормальная ослиная сыворотка) в течение 1 ч, а затем инкубировали 5 дней для сетчатки с плоским креплением и 3 дня. для срезов при 4 ° C с первичными антителами в блокирующем растворе.Первичные антитела включали поликлональные антитела кролика 1: 1000 против GFP с конъюгированными Alexa 488 (Life Technologies, Карлсбад, Калифорния, каталожный номер A-21311) и поликлональные антитела против TRPM1 1: 1000 (предоставлены доктором Кириллом Мартемьяновым, Научно-исследовательский институт Скриппса). , Юпитер, Флорида). После инкубации с первичным антителом кусочки сетчатки промывали 1 × PBS, а затем инкубировали с ослиным вторичным антителом против овцы Alexa Fluor 546 1: 1000 в 1 × PBS (Life technologies, Карлсбад, Калифорния, номер по каталогу A-21098). Срезы инкубировали при комнатной температуре в течение 2 ч, а плоские кусочки сетчатки инкубировали при 4 ° C в течение ночи.Затем все кусочки сетчатки промывали 1 × PBS (6 × 10 мин), наносили на среду Vectashield, содержащую DAPI (Vector Laboratories, Burlingame, CA, Inc., номер по каталогу H-1200), и закрывали покровные стекла. Два слоя парафильма использовались в качестве разделителя вокруг срезов, а плоские части были закреплены фоторецепторами вверх с помощью клейкой ленты, используемой в качестве разделителя, окружающего ткань. Изображения с большим увеличением (объектив 20 или 40 раз) получали с помощью конфокальной микроскопии (микроскоп Olympus Fluoview FV1000, оборудованный камерой Hamamatsu EM Image CCD).Биполярные клетки, которые ранее были записаны и заполнены сульфородамином (см. Следующий раздел), были идентифицированы по их ярко-красной флуоресценции, которая полностью заполнила клетку, в отличие от более слабой мембранно-специфической метки TRPM1.

Записи отдельных ячеек

Мышей анестезировали внутрибрюшинной инъекцией раствора Рингера, содержащего кетамин / ксилазин (127/12 мг / кг, соответственно), и умерщвляли смещением шейки матки. Глаза были энуклеированы, сетчатка удалена.Срезы сетчатки были сделаны и затем помещены в записывающую камеру. Стеклянные электроды заполняли внутриклеточным раствором, который содержал раствор Cs-глюконата (20 мМ CsCl, 107 мМ CsOH, 107 мМ-глюконовая кислота, 10 мМ NaHEPES, 10 мМ BAPTA, 4 мМ АТФ и 1 мМ GTP). Внутриклеточный раствор содержал 1% сульфородамина для визуализации клетки и классификации ее морфологии (64). Для блокирования ингибирующих входов в раствор ванны Эймса добавляли следующее: 1 мкМ стрихнина, 100 мкМ пикротоксина и 50 мкМ 6-тетрагидропиридин-4-илметилфосфиновой кислоты.L-AP4 (4 мкМ) добавляли к раствору ванны для насыщения рецепторов mGluR6. Капсаицин (10 мкМ), агонист TRPM1, наносили на дендриты стержня BC, чтобы закрыть отверстие канала TRPM1. Сомы стержня BC были нацелены на запись целых клеток с помощью патч-зажима. На стержневых BC было зафиксировано напряжение +50 мВ (25,28,65). Капсаицин (10 мкМ) наносили на стержневые дендриты BC в течение 200 мс и 1 с, чтобы закрыть открытие канала TRPM1. От каждой ячейки записывали от трех до пяти ответов, а затем усредняли.Программное обеспечение Prism 5.04 (GraphPad Software) использовалось для выполнения теста Краскела – Уоллиса с апостериорным тестом Данна . Статистическая значимость обозначена как ** P <0,01 и *** P <0,001. Планки погрешностей показывают стандартную ошибку среднего. Дополнительные методологические детали опубликованы (28).

Количественная оценка мРНК с помощью ПЦР в реальном времени

Обработанные и необработанные глаза мышей Nyx nob и контрольных мышей дикого типа того же возраста были энуклеированы через 4 недели после инъекции, и сетчатка немедленно отделялась от наглазника и погружалась в RNA Protect (Qiagen, Inc., Валенсия, Калифорния). Сетчатку ( n = 1 на условие) гомогенизировали в буфере для лизиса (Buffer RLT; RNeasy Protect Mini Kit; Qiagen, Inc.) плюс βME в течение 45 с. Экстракцию РНК проводили с помощью набора для стабилизации и очистки (RNeasy Protect Mini Kit; Qiagen, Inc.). После измерения концентрации РНК (Nanodrop, ThermoFisher, Wilmington, DE) 5 мкг РНК обрабатывали ДНКазой I для удаления загрязняющей ДНК (Ambion, Foster City, CA). Один микрограмм РНК, обработанной ДНКазой, подвергали обратной транскрипции (набор для синтеза кДНК iScript; Bio-Rad Laboratories, Hercules, CA) и использовали в ПЦР в реальном времени (Applied Biosystems TaqMan Gene Expression Master Mix и система обнаружения ПЦР CFX96, сопряженная с термопарой C1000 Touch. cycler; Bio-Rad Laboratories) для измерения AAV-опосредованных транскриптов Nyx и глицеральдегид-3-фосфатдегидрогеназы ( Gapdh ) в обработанных P2 и P30 Nyx nob сетчатках и контрлатеральных контрольных тканях, обработанных P2 и P30.

Смеси PrimeTime, содержащие пары праймеров и зонд (Integrated DNA Technologies (IDT), Coralville, IA) для каждого транскрипта, включены в таблицу 1. Опосредованные AAV пары праймеров Nyx были сконструированы для фланкирования гена 3 ' Nyx и 5 'SV40 polyA и генерируют ампликон 150 п.о. Сайты внутренней рестрикции в ампликоне использовали для разрезания продукта ПЦР и анализа с помощью электрофореза. Если используется предварительно созданный набор IDT, это не проблема, поскольку существует специфичный для мишени зонд, который может отжигать только для секвенирования внутри ампликона.Перед сбором экспериментальных данных смеси PrimeTime были проверены в соответствии с минимальным объемом информации для публикации стандартов количественных ПЦР-экспериментов в реальном времени (66). Результаты представляют собой среднее значение трех повторных реакций и были рассчитаны с использованием метода ΔΔC q с сигналами, нормализованными к Gapdh и выражением относительно нуля.

Дополнительные материалы

Дополнительные материалы доступны в HMG онлайн.

Финансирование

Работа поддержана R01 EY024280 (S.EB), R01 140701 (MAM), R01 EY12354 (RGG), Genome British Columbia AGCP-CanEuCre-01 (EMS), Фонд борьбы со слепотой, Департамент по делам ветеранов и неограниченные гранты как для Университета Флориды, так и для Университета Луисвилля. из исследования по предотвращению слепоты (RPB).

Благодарности

Мы благодарны Лаборатории вектора генной терапии сетчатки при Университете Флориды за упаковку AAV. Мы также благодарим докторов Клея Смита и Кирилла Мартемьянова за предоставление антител к GFP и TRPM1 соответственно.

Заявление о конфликте интересов . S.E.B., S.L.B., F.M.D. и E.M.S. являются соавторами предварительного патента «UF # 14807-Высокоселективная трансдукция ON биполярных клеток из вектора AAV, доставленного в стекловидное тело». E.M.S. и C.N.D.L. также являются соавторами патента США 9 006 413 B2 «Мини-промоторы PCP2».

Список литературы

1

Zeitz

C.

,

Robson

A.G.

,

Audo

I.

(

2015

)

Врожденная стационарная куриная слепота: анализ и обновление генотип-фенотипических корреляций и патогенетических механизмов 95000.

Прог. Ретин. Eye Res.

,

45

,

58

-

110

,2

Miyake

Y.

,

Yagasaki

K.

,

Horiguchi

M.

,

Kawase

T.

(

1986

)

Врожденная стационарная куриная слепота с отрицательной электроретинограммой. Новая классификация

.

Arch. Офтальмол.

,

104

,

1013

-

1020

.3

Carr

R.E.

(

1974

)

Врожденная стационарная ночная слепота

.

Пер. Являюсь. Офтальмол. Soc.

,

72

,

448

-

487

,4

Dryja

T.P.

,

McGee

T.L.

,

Берсон

E.L.

,

Фишман

Г.А.

,

Sandberg

M.A.

,

Alexander

K.R.

,

Дерлацки

Д.J.

,

Rajagopalan

A.S.

(

2005

)

Ночная слепота и аномальная электроретинограмма колбочки НА ответы у пациентов с мутациями в гене GRM6, кодирующем mGluR6

.

Proc. Natl. Акад. Sci. США

,

102

,

4884

-

4889

.5

Pinto

L.H.

,

Vitaterna

M.H.

,

Shimomura

K.

,

Siepka

S.M.

,

Баланник

В.

,

МакДирмон

E.L.

,

Omura

C.

,

Lumayag

S.

,

Invergo

B.M.

,

Glawe

B.

et al. . (

2007

)

Получение, идентификация и функциональная характеристика мутации nob4 Grm6 у мыши

.

Visual Neurosci.

,

24

,

111

-

123

,6

Масу

M.

,

Iwakabe

H.

,

Tagawa

Y.

,

Miyoshi

T.

,

Yamashita

M.

,

Fukuda

Y.

,

Sasaki

H.

K.,

Накамура

Y.

,

Shigemoto

R.

et al. . (

1995

)

Специфический дефицит ответа ON при зрительной передаче за счет целенаправленного нарушения гена mGluR6

.

Ячейка

,

80

,

757

-

765

.7

Xu

Y.

,

Dhingra

A.

,

Fina

ME

,

Koike

C.

,

Furukawa

T.

,

Vardi 9000

2012

)

Делеция mGluR6 делает канал TRPM1 в сетчатке неактивным

.

J. Neurophysiol.

,

107

,

948

-

957

,8

Zeitz

C.

,

van Genderen

M.

,

Neidhardt

J.

,

Luhmann

U.F.

,

Hoeben

F.

,

Forster

U.

,

Wycisk

K.

,

Matyas

G.

,

Hoyng

C.B.

000 и др.

. (

2005

)

Мутации в GRM6 вызывают аутосомно-рецессивную врожденную стационарную куриную слепоту с характерной скотопической электроретинограммой с мерцанием 15 Гц

.

Инвест. Офтальмол. Vis. Sci.

,

46

,

4328

-

4335

,9

Накамура

М.

,

Сануки

р.

,

Ясума

T.R.

,

Onishi

A.

,

Nishiguchi

K.M.

,

Koike

C.

,

Kadowaki

M.

,

Kondo

M.

,

Miyake

Y.

,

Furukawa

T.

(

2010

)

Мутации TRPM1 связаны с полной формой врожденной стационарной куриной слепоты

.

Мол. Vis.

,

16

,

425

-

437

.10

Audo

I.

,

Коль

S.

,

Leroy

B.P.

,

Munier

F.L.

,

Guillonneau

X.

,

Mohand-Said

S.

,

Bujakowska

K.

,

Nandrot

E.F.

,

Lorenz

B.

,

Preising

M.

et al. . (

2009

)

TRPM1 мутирован у пациентов с аутосомно-рецессивной полной врожденной стационарной куриной слепотой

.

г. J. Hum. Genet.

,

85

,

720

-

729

.11

van Genderen

M.M.

,

Бийвелд

М.М.

,

Claassen

Y.B.

,

Florijn

R.J.

,

Pearring

J.N.

,

Meire

F.M.

,

McCall

MA

,

Riemslag

F.C.

,

Грегг

R.G.

,

Берген

A.A.

et al. . (

2009

)

Мутации в TRPM1 являются частой причиной полной врожденной стационарной куриной слепоты

.

г. J. Hum. Genet.

,

85

,

730

-

736

.12

Li

Z.

,

Sergouniotis

P.I.

,

Michaelides

M.

,

Mackay

D.S.

,

Wright

G.A.

,

Devery

S.

,

Moore

A.T.

,

Держатель

G.E.

,

Робсон

A.G.

,

Webster

A.R.

(

2009

)

Рецессивные мутации гена TRPM1 отменяют функцию биполярных клеток ON и вызывают полную врожденную стационарную куриную слепоту у людей

.

г. J. Hum. Genet.

,

85

,

711

-

719

.13

Peachey

N.S.

,

Ray

T.A.

,

Florijn

R.

,

Rowe

L.B.

,

Sjoerdsma

T.

,

Contreras-Alcantara

S.

,

Baba

K.

,

Tosini

G.

,

Pozdeyev

N.

M.

et al. . (

2012

)

GPR179 необходим для деполяризующей функции биполярных клеток и мутировал при аутосомно-рецессивной полной врожденной стационарной куриной слепоте

.

г. J. Hum. Genet.

,

90

,

331

-

339

.14

Audo

I.

,

Bujakowska

K.

,

Orhan

E.

,

C. Poloschek

.

,

Defoort-Dhellemmes

S.

,

Drumare

I.

,

Kohl

S.

,

Luu

T.D.

,

Lecompte

O.

,

Zrenner

E.

et al. . (

2012

)

Секвенирование всего экзома выявляет мутации в GPR179, ведущие к аутосомно-рецессивной полной врожденной стационарной куриной слепоте

.

г. J. Hum. Genet.

,

90

,

321

-

330

.15

Bech-Hansen

N.T.

,

Naylor

M.J.

,

Maybaum

T.A.

,

Sparkes

R.L.

,

Koop

B.

,

Birch

D.G.

,

Берген

A.A.

,

Prinsen

C.F.

,

Polomeno

R.C.

,

Gal

A.

et al. . (

2000

)

Мутации в NYX, кодирующие богатый лейцином протеогликан никталопин, вызывают Х-сцепленную полную врожденную стационарную ночную слепоту

.

Nat. Genet.

,

26

,

319

-

323

.16

Pardue

M.T.

,

McCall

M.A.

,

LaVail

M.M.

,

Грегг

R.G.

,

Пичи

Н.С.

(

1998

)

Встречающаяся в природе мышиная модель Х-сцепленной врожденной стационарной куриной слепоты

.

Инвест офтальмол. Vis. Sci.

,

39

,

2443

-

2449

.17

Грегг

R.G.

,

Mukhopadhyay

S.

,

Candille

S.I.

,

Ball

S.L.

,

Pardue

M.T.

,

McCall

M.A.

,

Peachey

N.S.

(

2003

)

Идентификация гена и мутации, ответственных за фенотип nob мыши

.

Инвест офтальмол. Vis. Sci.

,

44

,

378

-

384

.18

Zeitz

C.

,

Jacobson

S.G.

,

Hamel

C.P.

,

Bujakowska

K.

,

Neuille

M.

,

Orhan

E.

,

Zanlonghi

X.

,

Lancelot

ME

000

000

000 C.

000 C. Шварц

SB

et al. . (

2013

)

Секвенирование всего экзома определяет мутации LRIT3 как причину аутосомно-рецессивной полной врожденной стационарной куриной слепоты

.

г. J. Hum. Genet.

,

92

,

67

-

75

.19

Neuille

M.

,

El Shamieh

S.

,

Orhan

E.

,

Michiels

Антонио

A.

,

Lancelot

ME

,

Condroyer

C.

,

Bujakowska

K.

,

Poch

O.

,

Sahel

J.A.

et al. . (

2014

)

Мышь с дефицитом Lrit3 (nob6): новая модель полной врожденной стационарной куриной слепоты (cCSNB)

.

PLoS One

,

9

,

e

.20

Nakajima

Y.

,

Iwakabe

H.

,

Akazawa

C.

000

Nawa 9000

Nawa 9000

Р.

,

Мизуно

Н.

,

Наканиши

С.

(

1993

)

Молекулярная характеристика нового метаботропного глутаматного рецептора сетчатки mGluR6 с высокой агонистической селективностью в отношении L-2-амино-4-фосфонобутирата

.

J. Biol. Chem.

,

268

,

11868

-

11873

,21

Nomura

A.

,

Shigemoto

R.

,

Nakamura

Y.

,

Okamoto

, Okamoto

Н.

,

Наканиши

С.

(

1994

)

Регулируемая в процессе развития постсинаптическая локализация метаботропного рецептора глутамата в биполярных клетках палочек крысы

.

Cell

,

77

,

361

-

369

.22

Nawy

S.

(

1999

)

Метаботропный рецептор mGluR6 может передавать сигналы через G (o), но не фосфодиналы биполярные клетки

.

J. Neurosci. Выключенный. J. Soc. Neurosci.

,

19

,

2938

-

2944

.23

Dhingra

A.

,

Lyubarsky

A.

,

Jiang

M.

,

Pugh

E.N.

Jr,

Birnbaumer

L.

,

Sterling

P.

,

Vardi

N.

(

2000

)

Световой ответ ON биполярных нейронов требует Gα o

.

J. Neurosci. Выключенный. J. Soc. Neurosci.

,

20

,

9053

-

9058

.24

Morgans

C.W.

,

Zhang

J.

,

Jeffrey

B.G.

,

Нельсон

S.M.

,

Берк

Н.С.

,

Duvoisin

R.M.

,

Коричневый

R.L.

(

2009

)

TRPM1 необходим для деполяризующего светового ответа в ON-биполярных клетках сетчатки

.

Proc. Natl. Акад. Sci. США

,

106

,

19174

-

19178

.25

Shen

Y.

,

Heimel

J.A.

,

Камерманс

М.

,

Пичи

Н.С.

,

Грегг

R.G.

,

Nawy

S.

(

2009

)

Переходный рецепторный потенциалоподобный канал опосредует синаптическую передачу в стержневых биполярных клетках

.

J. Neurosci. Выключенный. J. Soc. Neurosci.

,

29

,

6088

-

6093

.26

Koike

C.

,

Obara

T.

,

Uriu

Y.

,

Numata

T.

,

Sanuki

R.

,

Miyata

K.

,

Koyasu

Koyasu

Ueno

S.

,

Funabiki

K.

,

Tani

A.

et al. . (

2010

)

TRPM1 является компонентом биполярного канала трансдукции ON сетчатки в каскаде

mGluR6.

Proc. Natl. Акад. Sci. США

,

107

,

332

-

337

.27

Pearring

J.N.

,

Bojang

P.

Jr,

Shen

Y.

,

Koike

C.

,

Furukawa

T.

,

Nawy

S.

R.

Gregg

Gregg

(

2011

)

Роль никталопина, небольшого богатого лейцином белка повтора, в локализации канала меластатина 1 TRP на ретинальных деполяризующих дендритах биполярных клеток

.

J. Neurosci. Выключенный. J. Soc. Neurosci.

,

31

,

10060

-

10066

,28

Ray

T.A.

,

Heath

K.M.

,

Hasan

N.

,

Noel

J.M.

,

Samuels

I.S.

,

Мартемьянов

К.А.

,

Пичи

Н.С.

,

McCall

M.A.

,

Gregg

R.G.

(

2014

)

GPR179 необходим для высокой чувствительности сигнального каскада mGluR6 в деполяризующих биполярных клетках

.

J. Neurosci. Выключенный. J. Soc. Neurosci.

,

34

,

6334

-

6343

,29

Цао

Ю.

,

Посохова

Э.

,

Мартемьянов

К.А.

(

2011

)

TRPM1 образует комплексы с никталопином in vivo и накапливается в постсинаптическом компартменте ON-биполярных нейронов mGluR6-зависимым образом

.

J. Neurosci. Выключенный. J. Soc. Neurosci.

,

31

,

11521

-

11526

.30

Neuille

M.

,

Morgans

C.W.

,

Cao

Y.

,

Orhan

E.

,

Michiels

C.

,

000 Sahel

Sahel

,

Audo

I.

,

Duvoisin

R.M.

,

Мартемьянов

К.А.

,

Zeitz

C.

(

2015

)

LRIT3 необходим для локализации TRPM1 на концах дендритов деполяризующих биполярных клеток и может играть роль в формировании синапсов колбочек

.

евро. J. Neurosci.

,

42

,

1966

-

1975

.31

Бейнбридж

J.W.

,

Смит

А.Дж.

,

Barker

S.S.

,

Robbie

S.

,

Henderson

R.

,

Balaggan

K.

,

Viswanathan

A.

G.

G. Держатель

,

Stockman

A.

,

Tyler

N.

et al. . (

2008

)

Влияние генной терапии на зрительную функцию при врожденном амаврозе Лебера

.

N. Engl. J. Med.

,

358

,

2231

-

2239

.32

Банин

E.

,

Bandah-Rozenfeld

D.

,

Оболенский

A.

c,

Cide

,

Алеман

Т.С.

,

Маркс-Охана

Д.

,

Села

М.

,

Boye

S.

,

Sumaroka

A.

,

Roman

A.J.

et al. . (

2010

)

Молекулярная антропология встречается с генетической медициной для лечения слепоты у еврейского населения Северной Африки: генная терапия человека начата в Израиле

.

Hum. Gene Ther.

,

21

,

1749

-

1757

.33

Boye

S.E.

,

Boye

S.L.

,

Левин

А.S.

,

Hauswirth

W.W.

(

2013

)

Всесторонний обзор генной терапии сетчатки

.

Мол. Ther.

,

21

,

509

-

519

.34

Cideciyan

A.V.

,

Алеман

Т.С.

,

Boye

S.L.

,

Schwartz

S.B.

,

Kaushal

S.

,

Roman

A.J.

,

Панг

Дж.J.

,

Sumaroka

A.

,

Windsor

E.A.

,

Wilson

J.M.

et al. . (

2008

)

Человеческая генная терапия дефицита изомеразы RPE65 активирует ретиноидный цикл зрения, но с медленной кинетикой стержней

.

Proc. Natl. Акад. Sci. США

,

105

,

15112

-

15117

.35

Jacobson

S.G.

,

Cideciyan

A.V.

,

Ратнакарам

р.

,

Heon

E.

,

Schwartz

S.B.

,

Роман

A.J.

,

Peden

M.C.

,

Алеман

Т.С.

,

Boye

S.L.

,

Сумарока

A.

et al. . (

2012

)

Генная терапия врожденного амавроза Лебера, вызванного мутациями RPE65: безопасность и эффективность у 15 детей и взрослых, наблюдавшихся до 3 лет

.

Arch. Офтальмол.

,

130

,

9

-

24

,36

MacLaren

R.E.

,

Groppe

M.

,

Barnard

A.R.

,

Cottriall

C.L.

,

Толмачева

T.

,

Seymour

L.

,

Clark

K.R.

,

В течение

M.J.

,

Cremers

F.P.

,

Черный

G.C.

et al. .(

2014

)

Генная терапия сетчатки у пациентов с хориидеремией: первоначальные результаты клинического исследования 1/2 фазы

.

Ланцет

,

383

,

1129

-

1137

.37

Maguire

A.M.

,

Simonelli

F.

,

Pierce

E.A.

,

Пью

E.N.

Jr,

Mingozzi

F.

,

Bennicelli

J.

,

Banfi

S.

,

Маршалл

К.А.

,

Testa

F.

,

Surace

E.M.

et al. . (

2008

)

Безопасность и эффективность переноса генов при врожденном амаврозе Лебера

.

N. Engl. J. Med.

,

358

,

2240

-

2248

0,38

Далкара

Д.

,

Колстад

К.Д.

,

Caporale

N.

,

Visel

M.

,

Klimczak

R.R.

,

Schaffer

D.V.

,

Flannery

J.G.

(

2009

)

Внутренние ограничивающие мембранные барьеры для AAV-опосредованной трансдукции сетчатки из стекловидного тела

.

Мол. Ther.

,

17

,

2096

-

2102

.39

Кей

C.N.

,

Ryals

R.C.

,

Асланиди

Г.В.

,

мин.

S.H.

,

Ruan

Q.

,

Sun

J.

,

Dyka

F.M.

,

Kasuga

D.

,

Ayala

A.E.

,

Van

V.K.

et al. . (

2013

)

Нацеливание на фоторецепторы посредством интравитреальной доставки с использованием новых векторов AAV с мутированными капсидом

.

PLoS One

,

8

,

e62097

.40

Doroudchi

M.M.

,

Гринберг

К.P.

,

Liu

J.

,

Silka

K.A.

,

Boyden

E.S.

,

Локридж

J.A.

,

Arman

A.C.

,

Janani

R.

,

Boye

S.E.

,

Boye

S.L.

et al. . (

2011

)

Вирусно доставленный каналродопсин-2 безопасно и эффективно восстанавливает зрительную функцию в нескольких моделях слепоты у мышей

.

Мол. Ther.

,

19

,

1220

-

1229

.41

Mace

E.

,

Caplette

R.

,

Marre

O.

,

Sengupta

A.

,

Barbe

P.

,

Desrosiers

M.

,

Bamberg

E.

,

Sahel

JA

,

Picaud

S.

et al.. (

2015

)

Нацеливание канала родопсина-2 на ON-биполярные клетки с витреально введенным AAV Восстанавливает включенные и выключенные зрительные реакции у слепых мышей

.

Мол. Ther.

,

23

,

7

-

16

.42

Cronin

T.

,

Vandenberghe

LH

,

Hantz

P.

,

Juttner

iman

iman

А.

,

Качо

А.E.

,

Huckfeldt

R.M.

,

Busskamp

V.

,

Kohler

H.

,

Lagali

P.S.

et al. . (

2014

)

Эффективная трансдукция и оптогенетическая стимуляция биполярных клеток сетчатки синтетическим капсидом аденоассоциированного вируса и промотором

.

EMBO Mol. Med.

,

6

,

1175

-

1190

.43

Gaub

B.M.

,

Берри

м.H.

,

Holt

AE

,

Reiner

A.

,

Kienzler

MA

,

Dolgova

N.

,

Nikonov

S.

,

Agu Белтран

WA

,

Flannery

JG

et al. . (

2014

)

Восстановление зрительной функции путем экспрессии светозащитного ионного канала млекопитающих в ганглиозных клетках сетчатки или ON-биполярных клетках

.

Proc. Natl. Акад. Sci. США

,

111

,

E5574

-

E5583

.44

van Wyk

M.

,

Pielecka-Fortuna

J.

,

Lowel

S.

0002000 S.

,

(

2015

)

Восстановление выключателя при слепой сетчатке: Opto-mGluR6, оптогенетический инструмент нового поколения, адаптированный для клеток

.

PLoS Biol.

,

13

,

e1002143

.45

de Leeuw

C.N.

,

Dyka

F.M.

,

Boye

S.L.

,

Laprise

S.

,

Zhou

M.

,

Chou

A.Y.

,

Borretta

L.

,

McInerny

S.C.

,

Banks

K.G.

,

Порталес-Касамар

E.

et al. . (

2014

)

Нацеленная доставка в ЦНС с использованием человеческих MiniPromoters и продемонстрировала совместимость с аденоассоциированными вирусными векторами

.

Мол. Ther. Методы клин. Dev.

,

1

,

5

.46

Gregg

R.G.

,

Kamermans

M.

,

Klooster

J.

,

Lukasiewicz

P.D.

,

Пичи

Н.С.

,

Веси

К.А.

,

McCall

M.A.

(

2007

)

Экспрессия никталопина в биполярных клетках сетчатки восстанавливает зрительную функцию в мышиной модели полной Х-сцепленной врожденной стационарной куриной слепоты

.

J. Neurophysiol.

,

98

,

3023

-

3033

.47

Bahadori

R.

,

Biehlmaier

O.

,

Zeitz

C.

,

Т.

000, Labhart

,

T.

YV

,

Forster

U.

,

Gesemann

M.

,

Berger

W.

,

Neuhauss

SC

(

2006

)

Некталопин преобладает в передаче синаптических смолистиков. сетчатка

.

евро. J. Neurosci.

,

24

,

1664

-

1674

.48

Morgans

CW

,

Ren

G.

,

Akileswaran

L.

(

2006

в регионе

2006

) сетчатка млекопитающих

.

евро. J. Neurosci.

,

23

,

1163

-

1171

.49

Pesch

K.

,

Zeitz

C.

,

Fries

J.E.

,

Munscher

S.

,

Pusch

C.M.

,

Kohler

K.

,

Berger

W.

,

Wissinger

B.

(

2003

)

Выделение гена никталопина NYX мыши и исследования экспрессии на сетчатке мыши и крысы

.

Инвест офтальмол. Vis. Sci.

,

44

,

2260

-

2266

.50

Ширато

С.

,

Маеда

Х.

,

Miura

G.

,

Frishman

L.J.

(

2008

)

Пострецепторный вклад в адаптированную к свету ЭРГ мышей, лишенных b-волн

.

Exp. Eye Res.

,

86

,

914

-

928

.51

Peachey

N..S.

,

Pearring

J.N.

,

Bojang

P.

Jr,

Hirschtritt

M.E.

,

Sturgill-Short

G.

,

Ray

T.A.

,

Furukawa

T.

,

Koike

C.

,

Goldberg

A.F.

,

Shen

Y.

et al. . (

2012

)

Деполяризующая дисфункция биполярных клеток из-за точечной мутации Trpm1

.

J. Neurophysiol.

,

108

,

2442

-

2451

.52

Rapaport

D.H.

,

Wong

L.L.

,

Wood

E.D.

,

Ясумура

D.

,

LaVail

M.M.

(

2004

)

Время и топография клеточного генезиса в сетчатке крысы

.

J. Comp. Neurol.

,

474

,

304

-

324

.53

Cepko

C.

(

2014

)

По своей природе разные клетки-предшественники сетчатки производят определенные типы потомства

.

Nat.Rev. Neurosci.

,

15

,

615

-

627

.54

Hubel

D.H.

,

Wiesel

T.N.

,

LeVay

S.

(

1977

)

Пластичность столбиков глазного доминирования в полосатой коре головного мозга обезьян

.

Philos. Пер. R. Soc. Лондон, сер. B

,

278

,

377

-

409

.55

Dunn

F.A.

,

Della Santina

L.

,

Parker

E.D.

,

Вонг

Р.О.

(

2013

)

Сенсорный опыт определяет развитие первого синапса зрительной системы

.

Neuron

,

80

,

1159

-

1166

.56

Chakraborty

R.

,

Park

H.N.

,

Hanif

A.M.

,

Сидху

C.

,

Iuvone

P.M.

,

Пардью

М.T.

(

2015

)

Мутации пути ON повышают восприимчивость к миопии с депривацией формы

.

Exp. Eye Res.

,

137

,

79

-

83

.57

Pardue

M.T.

,

Faulkner

A.E.

,

Fernandes

A.

,

Yin

H.

,

Schaeffel

F.

,

Williams

R.W.

,

N.W.

,

N.

,

Iuvone

PM

(

2008

)

Высокая восприимчивость к экспериментальной миопии у мышей с дефектом сетчатки

.

Инвест офтальмол. Vis. Sci.

,

49

,

706

-

712

.58

Sarnaik

R.

,

Chen

H.

,

Liu

X.

,

Cang

2014

)

Генетическое нарушение зрительного пути влияет на селективность кортикальной ориентации и контрастную чувствительность у мышей

.

J. Neurophysiol.

,

111

,

2276

-

2286

.59

Portales-Casamar

E.

,

Swanson

D.J.

,

Liu

L.

,

de Leeuw

C.N.

,

Банки

K.G.

,

Ho Sui

S.J.

,

Fulton

D.L.

,

Али

J.

,

Amirabbasi

M.

,

Arenillas

D.J.

et al. . (

2010

)

Регуляторный набор инструментов MiniPromoters для управления селективной экспрессией в мозге

.

Proc. Natl. Акад. Sci. США

,

107

,

16589

-

16594

.60

Jacobson

S.G.

,

Acland

G.M.

,

Aguirre

G.D.

,

Aleman

T.S.

,

Schwartz

S.B.

,

Cideciyan

A.V.

,

Zeiss

C.J.

,

Komaromy

A.M.

,

Kaushal

S.

,

Roman

A.J.

et al. . (

2006

)

Безопасность вектора рекомбинантного аденоассоциированного вируса типа 2-RPE65, доставленного путем субретинальной инъекции в глаз

.

Мол. Ther.

,

13

,

1074

-

1084

.61

Золотухин

С.

,

Гончар

М.

,

Золотухин

I.

,

Sakai

Y.

,

Loiler

S.

,

Fraites

T.J.

Jr,

Chiodo

V.A.

,

Филлипсберг

T.

,

Muzyczka

N.

,

Hauswirth

W.W.

et al. . (

2002

)

Производство и очистка рекомбинантных аденоассоциированных вирусных векторов серотипов 1, 2 и 5

.

Методы

,

28

,

158

-

167

.62

Jacobson

S.G.

,

Boye

S.L.

,

Алеман

Т.С.

,

Conlon

T.J.

,

Zeiss

C.J.

,

Roman

A.J.

,

Cideciyan

A.V.

,

Schwartz

S.B.

,

Комаромы

А.М.

,

Добрадж

М.

et al. . (

2006

)

Безопасность глазных приматов AAV2-RPE65, кандидата на лечение слепоты при врожденном амаврозе Лебера

.

Hum. Gene Ther.

,

17

,

845

-

858

.63

Boye

S.E.

,

Boye

S.L.

,

Pang

J.

,

Ryals

R.

,

Everhart

D.

,

Umino

Y.

,

Neeley

A.W.

,

Besharse

J.

,

Barlow

R.

,

Hauswirth

W.W.

(

2010

)

Функциональное и поведенческое восстановление зрения с помощью генной терапии у мышей с нокаутом гуанилатциклазы-1 (GC1)

.

PLoS One

,

5

,

e11306

.64

Ghosh

K.K.

,

Bujan

S.

,

Haverkamp

S.

,

Feigenspan

A.

,

Wassle

H.

(

2004

)

Типы биполярных клеток сетчатки

у мышей.

J. Comp. Neurol.

,

469

,

70

-

82

.65

Nawy

S.

(

2004

)

Снижение чувствительности трансдукционного тока mGluR6 у тигровой саламандры на биполярных клетках

.

J. Physiol.

,

558

,

137

-

146

.66

Bustin

S.A.

,

Benes

V.

,

Garson

J.A.

,

Hellemans

J.

,

Huggett

J.

,

Kubista

M.

,

Mueller

R.

,

Nolan

T.

,

Pf Шипли

GL

et al.. (

2009

)

Рекомендации MIQE: минимум информации для публикации количественных экспериментов ПЦР в реальном времени

.

Clin. Chem.

,

55

,

611

-

622

.

© Автор, 2015. Опубликовано Oxford University Press. Все права защищены. Для получения разрешений обращайтесь по электронной почте: [email protected]

.

Выполняет ли плей-офф колледжа футбола свое обещание? Выбросы, отсутствие нарушений предполагают иное

Брайан Келли пожал плечами.Ответ тренера Нотр-Дама пришел на один из величайших космических вопросов современной вселенной студенческого футбола.

Почему игры плей-офф колледжа футбола вообще не были близкими?

Плей-офф извергал поток денег и заставлял излишне заламывать руки каждый вторник вечером на шоу CFP Rankings, но игры в целом были менее чем убедительными.

Восемь из 12 предыдущих полуфинальных игр определялись по крайней мере с 17 очками.Средняя разница в победе в этих играх - более трех приземлений (21,25). В 18 играх плей-офф - полуфинале и национальном чемпионате вместе взятых - разница в победах составила почти 19 очков.

BK, вам слово для объяснений.

«Я действительно не могу вам сказать, - сказала Келли.

Если бы вы продавали CFP прямо сейчас, это было бы сложно продать. Телевизионные рейтинги CFP снижаются. За шесть лет проведения турнира только шесть команд выиграли игру. Только четыре выиграли минимум два.Трое из них находятся в этом плей-офф - Алабама, Клемсон и штат Огайо. Даже тогда Баккейз проиграл (0: 2) в CFP с тех пор, как выиграл первый чемпионат в 2014 году.

К счастью (или к сожалению), плей-офф с четырьмя командами заблокирован еще на шесть лет в соответствии с контрактом ESPN с CFP.

«Я подумал, что им следовало отменить боулинг и расширить плей-офф до восьми команд», - сказал CBS Sports один тренер из FBS. "Этот год был бы идеальным для этого."

Но вот мы вступаем в 7-й год CFP с прошлыми унижениями, которые стали лишь немного менее интересными, чем прошлые чемпионы. Полуфиналы этого сезона - № 1 Алабама против № 4 Нотр-Дам и № 2 Клемсон. против № 3 штата Огайо - особенные команды, которые являются одними из лучших и являются лучшими. Четыре команды участвовали в пяти из шести национальных чемпионатов CFP.

Начиная с первого года плей-офф в 2014 году, эти четверо также занимают первое (Клемсон), второе (Алабама), 10-е (штат Огайо) и 19-е (Нотр-Дам) места в национальном масштабе.Это указывает на некоторую ошеломляющую последовательность, но это не совсем точно отражает долю затруднений каждой программы в эпоху CFP.

Клемсону принадлежит проигрыш 17 (в последней январской игре против LSU). Алабама уступила Клемсону в титульном матче 2019 года 28. Полуфинальное поражение Клемсону 31: 0 в 2017 году заставило Урбана Мейера из штата Огайо переоснастить свой атакующий состав.

Часть этого оборота включала найм тренера квотербеков San Francisco 49ers на ту же должность в штате Огайо.Четыре года спустя Райан Дэй на посту главного тренера показывает 22: 1. Кевин Уилсон был назначен координатором нападения после ухода с должности тренера в Индиане. Если этого не произойдет, возможно, Дэй не в штате Огайо, оставив Уилсона своим командиром, когда Мейер ушел на пенсию. Оба находятся во втором плей-офф подряд.

«Иногда я просыпаюсь и просто вынужден немного себя ущипнуть», - сказал Дэй. «Это было не так давно, чтобы кто-либо мог подумать о том, чтобы оказаться в подобной ситуации».

Название праймера . Последовательность a .
PCP2-X_OL_V1 TTATTTGAAATGGGGTTAGTATAGA
PCP2-X_OR_V1 TGCCATTCCAGATGATAATCTA
PCP2-ABD_P1R_MluI_V1 ACGT ACGCGT TGGACTCCAGTCACTTTTC
PCP2-BD_P1L_V1 GGACACTTCATTGGCATAG
PCP2-B_P2R_V1 TATGCCAATGAAGTGTCC GGATCAGGAGGAGAAGAC
PCGAP2-B_P2L_Sac1473_V25 Последовательность a . +
PCP2-X_OL_V1 TTATTTGAAATGGGGTTAGTATAGA
PCP2-X_OR_V1 TGCCATTCCAGATGATAATCTA
PCP2-ABD_P1R_MluI_V1 ACGT ACGCGT TGGACTCCAGTCACTTTTC
PCP2-BD_P1L_V1 GGACACTTCATTGGCATAG
PCP2-B_P2R_V1 TATGCCAATGAAGTGTCC GGATCAGGAGGAGAAGAC
PCGAP2-B_P2L_SacI_VGC TCGAP2-B_P2L_SacI_VGC

(1) Алабама

30.27 баллов

1

(2) Клемсон

27,36 балла

3

(3) Штат Огайо

900

(4) Нотр-Дам

16,54 балла

10

Это не значит игнорировать потрясающую отделку CFP.Победное приземление Клемсона за одну секунду до конца чемпионата 2017 года против Алабамы может стать моментом номер один в программе. В полуфинале Роуз Боул-2018 Джорджия вернулась с 17-го вниз, чтобы обыграть Оклахому в двойном овертайме.

«Это игра из нескольких игр. Это игра, основанная на импульсе», - сказал тренер Клемсона Дабо Суинни. «В играх такого типа импульс - огромная вещь, и иногда игры могут ускользнуть».

Нотр-Дам все еще пытается пережить поражение 30: 3 от Клемсона два года назад в полуфинале CFP.Это в сочетании с поражением Алабамы со счетом 42: 0 в матче чемпионата BCS 2013 года сделало команду Fighting Irish, занявшую четвертое место, наиболее вероятной на этот раз.

Спрэд в 19,5 пункта в пользу Багрового прилива является самым большим в истории CFP.

«Мы стучимся в дверь каждый год», - сказала Келли. «Есть элитные футбольные команды. Я не знаю, почему этот рассказ продолжает всплывать, когда мы постоянно находимся в играх. Нет, мы не выиграли национальный чемпионат [со мной в качестве тренера], это правильно.Я не меняю запись. Но мы бываем там каждый год и стараемся, как и все остальные. Только одна команда может праздновать в конце года ».

Другие оскорбления плей-офф:

  • Pac-12 не слышал о CFP после полуфинального поражения от Алабамы с 17 очками четыре года назад.
  • The Big 12 остается единственной лигой Power Five без побед в плей-офф, уступая в сумме 72 очкам в четырех полуфинальных поражениях (все - Оклахоме).Одно семя было выиграно всего один раз, что говорит о некотором паритете. Но первым номером в прошлом году был LSU, который провел две игры плей-офф, обогнав оппонентов на 52 очка в, пожалуй, самом доминирующем сезоне за всю историю.
  • Из 18 игр CFP было только шесть неудач с разбросом по очкам. Трое из этих шести участвовали в национальных чемпионатах. Один из этих шести вряд ли считается, поскольку штат Огайо был всего лишь фаворитом на 1 очко, прежде чем проиграть Клемсону в Fiesta Bowl 2017 года.
  • Можно сказать, что CFP был менее увлекательным, чем система, которую он заменил.В 16 играх чемпионата BCS был определен средний результат 14,6 балла. Шесть из 16 игр были с одним счетом. Только пять из 18 игр CFP были решены в результате приземления или меньше.
  • В 18 играх CFP определялся средний результат 18,72 очка. По данным Pro Football Focus, это больше, чем средний запас победы для всех игр в 2020 году, который составлял 17,3 балла.

«Это не похоже на НФЛ, где в 70% игр решается приземление или меньше», - сказал тренер Алабамы Ник Сабан.«Кажется, что в студенческом футболе команды, которые могут набирать очки, обычно хорошо себя чувствуют в подобных играх. Вы должны уметь хорошо защищаться, чтобы не потерпеть поражение, прежде чем вы сможете выиграть».

Это может быть так же просто, как Алабама и Клемсон накинулись на всех за последние семь лет. Если Сильная Пятерка отделилась от Группы пяти, Прилив и Тигры отделились от всех остальных. Алабама и Клемсон занимают 1-2 места по проценту побед за последнее десятилетие.Без сутулости, штат Огайо занимает третье место. Ах да, и «Нотр-Дам» - пятая по победе программа всех времен.

Безусловно, ирландцы лучше, чем то полуфинальное поражение два года назад. Но они сталкиваются с, возможно, самой доминирующей командой Tide эпохи Сабана. Шесть отобранных Алабамой AP All-America были больше, чем Клемсон, штат Огайо и Нотр-Дам вместе взятые (пять).

«Самое замечательное в плей-офф… то, что к тому времени вы уже торгуете остроумием с людьми, которые столь же талантливы на поле», - сказал ветеран-тренер Терри Боуден, который в настоящее время переходит с должности аналитика Клемсона на новый тренер Луизианы-Монро.«Если ты не в своей лучшей форме… он появится, и он будет большим».

Один сотрудник Клемсона подчеркнул важность саморазведки. Другими словами: действительно ли мы хороши такими, какими мы думаем?

«Вы получаете 20 или более очков в каждой игре», - сказал он. «Хорошо ли мы поработали, или мы намного лучше?… Когда вы попадаете в огромную игру, это показывает, есть ли у вас шрамы или слабые места».

Еще одно соображение: все эти яркие, сверкающие бренды. Но неужели все это повторяется?

«CFP - или, скажем так, Power Five Invitational - не помогает сам по себе, если по пальцам подсчитать количество команд в августе, которые будут бороться за четыре места в январе», - сказал один из руководителей телевидения. .

Рейтинги телеканалов отражают это мнение. По данным Sports Media Watch, с 2014 по 2018 год рейтинги CFP снизились более чем на 25%. (В 2019 году цифры немного выросли.)

Матч чемпионата BCS 2006 года между Техасом и USC остается национальным чемпионатом с самым высоким рейтингом с 1998 года. Первый национальный чемпионат CFP в 2015 году (штат Орегон-Огайо) является вторым.

Текущий правообладатель ESPN испытывает финансовые затруднения, теряя абонентов кабельного телевидения, поскольку все больше потребителей отключаются и переходят на потоковые платформы.Пандемия COVID-19 вряд ли увеличит эти цифры в 2020 году.

Рассмотрим те шесть команд, которые выиграли хотя бы одну игру CFP - Алабама, Клемсон, Джорджия, Луизиана, штат Огайо и Орегон. Это предполагает, что в плей-офф, как и в BCS до него, доминирует SEC. Это хорошо для SEC, но плохо для разнообразия.

«До сих пор в эпоху CFP проводилось несколько ужасных неконкурентных игр», - сказал этот руководитель телевидения.

Одна простая причина: лучшие команды продолжают очень хорошо побеждать - крупно.С 2014 года средний запас побед Алабамы, штата Огайо и Клемсона составляет 1-2-3. Нотр-Дам делит 12-е место. Неудивительно, что впервые в плей-офф нет новичков. Все они были здесь раньше.

На первый взгляд, взрывоопасная природа CFP может служить аргументом против расширения. Больше (и, вероятно, меньше) команд не собираются делать CFP более конкурентоспособным. Но для некоторых все лучше, чем снова посмотреть Алабаму и Клемсона. Если оба выиграют свои полуфинальные игры, они встретятся в пятый раз за семь лет плей-офф.

Есть ли что-то более интересное, если Цинциннати и Техасский A&M будут в этом году?

«Меня беспокоило то, что как только у нас начнутся плей-офф, все внимание будет сосредоточено на командах в плей-офф, а к некоторым другим играм будет минимальный интерес», - сказал Сабан. «В основном упор делается на плей-офф. В некотором смысле это несправедливо по отношению к другим командам. Я не знаю, какое решение есть. Я знаю, что это та система, которая у нас есть».

Ураган Harry's College Station, Tx

Тристон Марез
с гостем Логаном Сэмфордом
ПОЛНОЕ БАНД-ШОУ
Пятница, 4 июня
Двери: 21:00

Pecos Hurley Of Pecos & The Rooftops
И Грейси Йорк
Серия Acoustic Summer
Среда, 9 июня
Двери: 21:00

Клето Кордеро из конницы Флатландии
и Кейтлин Баттс
Серия Acoustic Summer
Среда, 16 июня
Двери: 21:00

Майк Райан
W / Guest TBA
ПОЛНОЕ БАНД-ШОУ
Пятница, 18 июня
Двери: 21:00

Джош Уорд
И Джейк Уортингтон
Серия Acoustic Summer
Среда, 23 июня
Двери: 21:00

Коди Хиббард
И Карсон Джеффри
Серия Acoustic Summer
Среда, 30 июня
Двери: 21:00

JON WOLFE
W / GUEST TBA
ПОЛНОЕ БАНД-ШОУ
Пятница, 16 июля
Двери: 21:00

РЭНДИ РОДЖЕРС и
УЭЙД БОУЕН
HMB & WT ТУР
Среда, 21 июля
Двери: 21:00








ПОДПИСЫВАЙТЕСЬ НА НАС В TWITTER, ЧТОБЫ БЫТЬ ВСЕГО ПРОИСХОДИТ В РЕАЛЬНОМ ВРЕМЕНИ!

НРАВИТСЯ И ПОДПИСАТЬСЯ НА НАС НА FACEBOOK И ПОДПИСАТЬСЯ НА НАШИ СОБЫТИЯ FACEBOOK!

ПОДПИШИТЕСЬ НА INSTAGRAM!

Сегодня

В пятницу вечером

Открыт для танцев с ди-джеем в неконцертные пятницы! 18+ Добро пожаловать с действительным удостоверением личности $ 2 скважины 3 доллара США

Все цены могут быть изменены во время проведения специальных мероприятий и концертов.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *